ID: 1142866486

View in Genome Browser
Species Human (GRCh38)
Location 17:2794558-2794580
Sequence AAGCCTCCGGGCTCCTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 214}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142866477_1142866486 3 Left 1142866477 17:2794532-2794554 CCTGGGGCAGAGGTGAGGGTTGG 0: 1
1: 0
2: 9
3: 76
4: 608
Right 1142866486 17:2794558-2794580 AAGCCTCCGGGCTCCTGCTGGGG 0: 1
1: 0
2: 0
3: 21
4: 214
1142866474_1142866486 12 Left 1142866474 17:2794523-2794545 CCTAACTTTCCTGGGGCAGAGGT 0: 1
1: 0
2: 0
3: 18
4: 209
Right 1142866486 17:2794558-2794580 AAGCCTCCGGGCTCCTGCTGGGG 0: 1
1: 0
2: 0
3: 21
4: 214
1142866469_1142866486 21 Left 1142866469 17:2794514-2794536 CCACACAATCCTAACTTTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 148
Right 1142866486 17:2794558-2794580 AAGCCTCCGGGCTCCTGCTGGGG 0: 1
1: 0
2: 0
3: 21
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142866486 Original CRISPR AAGCCTCCGGGCTCCTGCTG GGG Intronic