ID: 1142871348

View in Genome Browser
Species Human (GRCh38)
Location 17:2823188-2823210
Sequence AAACAGCATCTGGACATCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 177}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142871348_1142871361 28 Left 1142871348 17:2823188-2823210 CCCAGGATGTCCAGATGCTGTTT 0: 1
1: 0
2: 0
3: 12
4: 177
Right 1142871361 17:2823239-2823261 GGGCCCCCACTTTGCCTGGGAGG 0: 1
1: 0
2: 1
3: 15
4: 168
1142871348_1142871351 -8 Left 1142871348 17:2823188-2823210 CCCAGGATGTCCAGATGCTGTTT 0: 1
1: 0
2: 0
3: 12
4: 177
Right 1142871351 17:2823203-2823225 TGCTGTTTTTGAAGCCCTATCGG 0: 1
1: 0
2: 0
3: 14
4: 135
1142871348_1142871352 -3 Left 1142871348 17:2823188-2823210 CCCAGGATGTCCAGATGCTGTTT 0: 1
1: 0
2: 0
3: 12
4: 177
Right 1142871352 17:2823208-2823230 TTTTTGAAGCCCTATCGGCCAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1142871348_1142871357 8 Left 1142871348 17:2823188-2823210 CCCAGGATGTCCAGATGCTGTTT 0: 1
1: 0
2: 0
3: 12
4: 177
Right 1142871357 17:2823219-2823241 CTATCGGCCAGGGAGTCAATGGG 0: 1
1: 0
2: 0
3: 0
4: 35
1142871348_1142871353 -2 Left 1142871348 17:2823188-2823210 CCCAGGATGTCCAGATGCTGTTT 0: 1
1: 0
2: 0
3: 12
4: 177
Right 1142871353 17:2823209-2823231 TTTTGAAGCCCTATCGGCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1142871348_1142871359 24 Left 1142871348 17:2823188-2823210 CCCAGGATGTCCAGATGCTGTTT 0: 1
1: 0
2: 0
3: 12
4: 177
Right 1142871359 17:2823235-2823257 CAATGGGCCCCCACTTTGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 125
1142871348_1142871360 25 Left 1142871348 17:2823188-2823210 CCCAGGATGTCCAGATGCTGTTT 0: 1
1: 0
2: 0
3: 12
4: 177
Right 1142871360 17:2823236-2823258 AATGGGCCCCCACTTTGCCTGGG 0: 1
1: 0
2: 1
3: 11
4: 152
1142871348_1142871362 29 Left 1142871348 17:2823188-2823210 CCCAGGATGTCCAGATGCTGTTT 0: 1
1: 0
2: 0
3: 12
4: 177
Right 1142871362 17:2823240-2823262 GGCCCCCACTTTGCCTGGGAGGG 0: 1
1: 0
2: 3
3: 18
4: 177
1142871348_1142871356 7 Left 1142871348 17:2823188-2823210 CCCAGGATGTCCAGATGCTGTTT 0: 1
1: 0
2: 0
3: 12
4: 177
Right 1142871356 17:2823218-2823240 CCTATCGGCCAGGGAGTCAATGG 0: 1
1: 0
2: 0
3: 7
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142871348 Original CRISPR AAACAGCATCTGGACATCCT GGG (reversed) Intronic
901454635 1:9356031-9356053 ATGCAGCAGCTGGACATCATAGG - Exonic
905476801 1:38234568-38234590 AAACAGAAACTGGAATTCCTAGG - Intergenic
906346463 1:45018535-45018557 AAACTGCAGGTGGCCATCCTGGG + Exonic
907719937 1:56962389-56962411 AAACAGCATCTTTAGTTCCTGGG + Intronic
909327105 1:74364567-74364589 AAACAGGACCTGAACATCTTTGG - Intronic
912836002 1:112996977-112996999 AAACAGAATCAGGATATCCCAGG + Intergenic
912996346 1:114535907-114535929 GCACAGCAGCTGCACATCCTGGG + Intergenic
915255362 1:154624404-154624426 AAGCAGCAACTAGACCTCCTTGG + Intronic
918642373 1:186858608-186858630 AAACTTCATCTGGACATCTAAGG + Intronic
920109923 1:203580641-203580663 AAGCAACTTCTGGCCATCCTGGG - Intergenic
920896828 1:210059561-210059583 GAACAGCCTCTTTACATCCTAGG - Intronic
921505323 1:215961494-215961516 AAACAGCATCAGGACTTCTGGGG + Intronic
922552575 1:226506942-226506964 AAGCAACACTTGGACATCCTTGG - Intergenic
923564016 1:235063131-235063153 AAACAGCATGTGCACACCCAGGG + Intergenic
924116014 1:240747842-240747864 AAAAAACATCTGGACAGCCAAGG + Intergenic
1064871854 10:19946420-19946442 AAATAGGATGTGGACATCATCGG - Intronic
1064943249 10:20758248-20758270 AAAAAGCATCTGCACATCACAGG + Intergenic
1067839614 10:49665385-49665407 AAGCATCACCTGGACATACTAGG - Intergenic
1068406919 10:56602202-56602224 AAACAGCATCTTCTCATCCTTGG + Intergenic
1068816923 10:61326666-61326688 AAAAAGTATCAGGACATCATTGG - Intergenic
1069263202 10:66425912-66425934 AGTCAGCATGTGGTCATCCTTGG - Intronic
1069918295 10:71800555-71800577 TAACAGCATCTGGCCATAGTAGG + Intronic
1071472928 10:85998225-85998247 ACACAGGATATGGACTTCCTTGG - Intronic
1074002385 10:109386471-109386493 TAACAGCATCTGAAGCTCCTGGG + Intergenic
1075378259 10:121997124-121997146 GACCAGCATCTGGGCATCATGGG + Intronic
1077544354 11:3162823-3162845 AAGCAGCATGAGGACATCCAGGG + Intronic
1078311161 11:10244689-10244711 AAAAAGCTTCTGAACATCCAAGG + Intronic
1079179598 11:18178240-18178262 AATCAGCATCTAGAAATCCCAGG + Intronic
1079265666 11:18929848-18929870 ATTCAGCATCTGGAAATCCCAGG - Intergenic
1091361825 11:134983910-134983932 AAACAGAATTTGGACCTACTTGG + Intergenic
1093106237 12:15090893-15090915 AAACAGCTACTGGTCAACCTGGG - Intergenic
1094692754 12:32785997-32786019 AAACAGCATCTGTACTACCCAGG - Intergenic
1095630722 12:44373754-44373776 AAAAAGGAAATGGACATCCTAGG - Intronic
1096558840 12:52421728-52421750 AAGCAGCAGCTGGACTGCCTGGG - Intergenic
1098368931 12:69737427-69737449 AAACAGCATATGGAAATACAGGG + Intergenic
1099946143 12:89246513-89246535 AAACTGCATTTGCACATCCTGGG - Intergenic
1101057983 12:100939318-100939340 AAAAAGAATATTGACATCCTTGG - Exonic
1101162730 12:101995345-101995367 GAACAGCATGTGGAAATACTGGG - Intronic
1102195520 12:111022559-111022581 AAAGAGCATCTGCTAATCCTGGG - Intergenic
1102390893 12:112547759-112547781 AAACAGCATCTCTCCTTCCTGGG - Intergenic
1102717811 12:114989318-114989340 AAACTGCAACCGGACAGCCTGGG + Intergenic
1103605819 12:122085310-122085332 TAACAGCTTCGGCACATCCTAGG + Intronic
1104172644 12:126297197-126297219 AAATAGCATCTGCATACCCTGGG + Intergenic
1107095715 13:36532783-36532805 AAGCAGCAGCTTGACATTCTTGG - Intergenic
1110519808 13:76462206-76462228 CATCTGCATCGGGACATCCTGGG + Intergenic
1112503358 13:99958502-99958524 AAATTGGATCTGGAGATCCTTGG + Intergenic
1114127102 14:19741285-19741307 AAAAAGCTTCTGCACATCCAAGG + Intronic
1114339877 14:21731810-21731832 GCACAGCATCTGGACAGGCTTGG - Intergenic
1115624180 14:35173469-35173491 AAACATGATCTGCACATGCTTGG - Intronic
1116802284 14:49455328-49455350 AAATAGAATGTGGACATCTTTGG - Intergenic
1117775961 14:59184816-59184838 AAACAGGAACTGGACAAACTAGG - Intergenic
1126463689 15:48940414-48940436 AAACTGAAACTCGACATCCTAGG - Intronic
1129057665 15:72833152-72833174 CAACAGTATCTGGACAAACTTGG + Intergenic
1131115202 15:89791093-89791115 AGACAGCATCTGGCCCTCTTAGG - Exonic
1132018552 15:98340108-98340130 AATTAGGATGTGGACATCCTTGG + Intergenic
1135268853 16:21051756-21051778 AATCTGCACCTGCACATCCTTGG + Exonic
1138542641 16:57697834-57697856 CAACACCATCTGGGCATCCCCGG - Intronic
1139041399 16:63003027-63003049 ACACAGCAACTTTACATCCTTGG + Intergenic
1139551481 16:67675404-67675426 GTACAGCAGCGGGACATCCTGGG + Exonic
1140038949 16:71392675-71392697 AAACAAGATCTGGATATTCTGGG - Intergenic
1141136069 16:81466416-81466438 ACACAGCAACTGCACATCCCTGG - Intronic
1142871348 17:2823188-2823210 AAACAGCATCTGGACATCCTGGG - Intronic
1144242294 17:13324613-13324635 TAACAGCATGTAGACTTCCTAGG - Intergenic
1147684661 17:42279964-42279986 AAACAGAATGTTGTCATCCTGGG + Intergenic
1154493492 18:14939149-14939171 AAACAGAATTTGGACCTACTTGG - Intergenic
1154966057 18:21357456-21357478 AAACAGCTTCTGCACAGCCAAGG - Intronic
1155901918 18:31401904-31401926 AACTATCATCTGTACATCCTGGG + Intronic
1156456595 18:37298212-37298234 AACCAGCATCTGCAGATCCTTGG - Intronic
1157029647 18:43890178-43890200 AAACAGCAGTTGGACCTCATGGG + Intergenic
1159035848 18:63276348-63276370 AAAAAGCATCTGGAAATCCATGG + Intronic
1160467584 18:79094490-79094512 AAACAGGATGTGGACGTCCCTGG - Intronic
1164390255 19:27813666-27813688 AAAGAGCATTCTGACATCCTAGG - Intergenic
1166296509 19:41892627-41892649 GAACCGCCGCTGGACATCCTCGG - Exonic
1167775978 19:51556232-51556254 AAACAGCTTCTGCACATCAAAGG + Intergenic
1168120567 19:54250650-54250672 AAAGACCACCAGGACATCCTGGG - Exonic
925824813 2:7837307-7837329 AAACAGCATATAGTAATCCTTGG + Intergenic
925853407 2:8106158-8106180 AAAATGAACCTGGACATCCTGGG + Intergenic
926272682 2:11378545-11378567 AAATAGCCACTGGACTTCCTGGG + Intergenic
926312666 2:11685925-11685947 ATAGAGCACTTGGACATCCTGGG + Intronic
928700696 2:33895823-33895845 AATTAGTATCTGGACATCTTTGG - Intergenic
929723905 2:44403131-44403153 AAACACCATATGGACAGCCAGGG - Intronic
931674201 2:64677659-64677681 AAGGAGCATATGGAGATCCTTGG - Intronic
931913212 2:66924959-66924981 GACCAGCATCTGGAAATCTTAGG + Intergenic
935345060 2:102100110-102100132 ACACACCATCTGCACATCGTCGG + Intronic
937548081 2:123049632-123049654 AACCATTATCTGGAGATCCTGGG - Intergenic
937844868 2:126568531-126568553 AAACAGGATCTTCACAACCTTGG + Intergenic
937996430 2:127698039-127698061 CCACCGCATCTGCACATCCTGGG - Intergenic
938370738 2:130766930-130766952 AAAAAGCATTTGGCCATCCATGG - Exonic
941028739 2:160487847-160487869 AATCAACATCTGAACCTCCTAGG - Intronic
941547948 2:166877254-166877276 AAACAATATCTGGACAGCCCAGG - Intergenic
942125646 2:172822577-172822599 ATACAGCATCTGGGCATTCCTGG - Intronic
945917031 2:215714835-215714857 AACCAGCAACTGGGCATCCAGGG - Intergenic
1169173003 20:3480693-3480715 AAAAAGCATCTGCCCATCTTGGG - Intronic
1169442801 20:5647004-5647026 CATCAGCCTCTGGACATGCTGGG - Intergenic
1169522175 20:6385960-6385982 AACCAGCATCATGGCATCCTTGG + Intergenic
1169615559 20:7440035-7440057 AAAGAGCTTCTGTGCATCCTTGG - Intergenic
1170309497 20:14976598-14976620 GAACAGGATGTGGACATACTTGG + Intronic
1170900915 20:20462371-20462393 AAAGTGCATCTGGACTCCCTAGG + Intronic
1173362694 20:42359046-42359068 AAACAGCATCAGCACCACCTGGG + Intronic
1173906765 20:46635117-46635139 AAACAGCAAGTGGTCTTCCTTGG - Intronic
1177446346 21:21201408-21201430 AAACAGCAAGTTTACATCCTGGG + Intronic
1179029437 21:37707517-37707539 TTACAGCATCAGGCCATCCTGGG - Intronic
1179943025 21:44651783-44651805 AACCAGGATGTGGACATCATTGG + Intronic
1182783787 22:32889543-32889565 AAACATTATCTTTACATCCTGGG - Intronic
1185341013 22:50291128-50291150 AAACAGCATGTGCACTTGCTGGG - Intronic
949672851 3:6419670-6419692 AAGAAGCATATGGTCATCCTAGG - Intergenic
949732156 3:7126068-7126090 AAACAGGATCAGGACAGCCTGGG + Intronic
952691695 3:36214418-36214440 AAATAGCAGCTGGACAACTTAGG - Intergenic
953183775 3:40619901-40619923 AAACAGCACCTGCAGAGCCTGGG - Intergenic
954253107 3:49383678-49383700 AGACAGAGTCTGGACATTCTAGG - Intronic
955466214 3:59239518-59239540 AGACAGGATATGGACATCTTTGG + Intergenic
956315754 3:67934534-67934556 AATTAGAATCTGGACATCTTTGG - Intergenic
956657068 3:71562857-71562879 ATACATAATCTGGACTTCCTGGG + Intronic
957016916 3:75076653-75076675 AAACAGCATCTGGTCTATCTTGG + Intergenic
957691525 3:83576966-83576988 AATCAGAACATGGACATCCTTGG + Intergenic
959296104 3:104536130-104536152 AAAGAGCTTCTGGACATCAGAGG + Intergenic
959368501 3:105493383-105493405 GAACAGAATCTGGACATCTTTGG - Intronic
960603345 3:119479959-119479981 CCACAGGATCTGGACAGCCTTGG - Intronic
960700897 3:120438387-120438409 AAACAGCATTTGGGATTCCTGGG + Intronic
960947418 3:122976209-122976231 CAGCAGCATCTGCACCTCCTGGG + Intronic
963752970 3:149202101-149202123 GAAGAGCATCTTGGCATCCTGGG - Exonic
963917901 3:150876837-150876859 TAACACCATCTGGAAAGCCTTGG - Intronic
964291817 3:155189512-155189534 AATTAGCATATGAACATCCTTGG - Intergenic
967317035 3:188159394-188159416 AAACAGCTACTGAACATCCTGGG - Intronic
968406879 4:348222-348244 AAACAGCCTCTGCACATCAAAGG - Intronic
970201859 4:13617614-13617636 CAACAGAATCTGAAAATCCTAGG - Intronic
970842506 4:20490980-20491002 AATAAGCATCTGGACATGCATGG - Intronic
972072197 4:35036235-35036257 AAACAGCTTCTGCACAGCCAAGG + Intergenic
972321733 4:37977972-37977994 CACCAGCCTCTGGGCATCCTCGG - Intronic
974349643 4:60728222-60728244 AAAAAGCTTCTGCACAGCCTAGG - Intergenic
975399678 4:73920073-73920095 AATCAGCATATGGACATTCTCGG + Intergenic
979338589 4:119492558-119492580 AGACAGCATCTCGAACTCCTAGG - Intergenic
980146594 4:128993127-128993149 AGACAGAATGAGGACATCCTGGG - Intronic
980329803 4:131395909-131395931 AAACAGCCTCAGGAGGTCCTGGG - Intergenic
985583658 5:714533-714555 CAAAAGCATCTGGTCTTCCTAGG - Intronic
985597168 5:798830-798852 CAAAAGCATCTGGTCTTCCTAGG - Intronic
988999087 5:36742613-36742635 AATCAGGATGTGGACATCTTTGG - Intergenic
990741047 5:58913189-58913211 TACAAGCATCTGGACATCATGGG + Intergenic
997488513 5:134252510-134252532 AAACATCATCTGGATATTATAGG - Intergenic
997624116 5:135320066-135320088 AAACTGCATCTGGAGAGCCCAGG + Intronic
998510876 5:142713069-142713091 AAACAGCATCTGTTCAGCTTGGG + Intergenic
998865610 5:146497480-146497502 GAACGACATCTGGACATCTTGGG + Intronic
999240473 5:150124632-150124654 AATCAGCATCAGGCCACCCTGGG + Intronic
1012642193 6:101632830-101632852 AAACAGCATCATGACATCTCAGG + Intronic
1013971315 6:116022956-116022978 ATTCAACATCTGGACATACTTGG - Intronic
1014333777 6:120104988-120105010 AAACTGAATGTGCACATCCTAGG + Intergenic
1014527105 6:122513990-122514012 TAACAGCATCTGCTCATCCTTGG + Intronic
1015971724 6:138749176-138749198 AAACAGGAGGTGGACATCTTTGG + Intergenic
1023150596 7:37198054-37198076 AGGCAGCATAAGGACATCCTCGG + Intronic
1023362646 7:39432120-39432142 AAACAGCAAATGGACAGACTGGG - Intronic
1026775499 7:73228646-73228668 AAACAGCATCAGCACCTCCACGG + Intergenic
1027016355 7:74782020-74782042 AAACAGCATCAGCACCTCCACGG + Intronic
1027071673 7:75163921-75163943 AAACAGCATCAGCACCTCCACGG - Intergenic
1029656003 7:101924895-101924917 AAACAGCATCCAGGCATCATCGG + Intronic
1030237417 7:107280313-107280335 AAACAAAATCTGGCCATCCATGG + Intronic
1030413166 7:109207687-109207709 GAATAGGATATGGACATCCTGGG - Intergenic
1032300073 7:130678680-130678702 TAACAGCATCTGGAGAACCTGGG - Intronic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1032795036 7:135270077-135270099 CAGCAGCATCTGAACAACCTGGG + Intergenic
1033126481 7:138711440-138711462 AAATAGCATCATTACATCCTTGG + Intronic
1036722553 8:11190302-11190324 AAACAGCTTCTTTATATCCTTGG + Intronic
1036748338 8:11426324-11426346 AAACAGTAACTGGACCACCTAGG + Intronic
1037980387 8:23249252-23249274 AGACAGCAGCTGGATCTCCTGGG + Exonic
1038740586 8:30213280-30213302 AGGCAGCATCTGGATAACCTGGG - Intergenic
1039716731 8:40118048-40118070 AAACAGCATGTGTAAAACCTTGG - Intergenic
1042118657 8:65460173-65460195 AAAGAGAATCTGAACATTCTTGG + Intergenic
1042721085 8:71827486-71827508 TCACAGCTTCAGGACATCCTTGG - Intergenic
1043548516 8:81341904-81341926 AAGCAGCATCTGGACAGTCTTGG + Intergenic
1044305113 8:90630702-90630724 AAAAAAAATCTGTACATCCTAGG + Intronic
1044400783 8:91769207-91769229 AAACAGCTTCATGATATCCTGGG - Intergenic
1044724580 8:95182735-95182757 ATTCTGCATCTGGAGATCCTTGG - Intergenic
1046408220 8:113803125-113803147 AAACAGAATCTTGCCATGCTAGG - Intergenic
1046914668 8:119667208-119667230 ACACAGAATCTTGAAATCCTAGG + Intronic
1048465448 8:134661523-134661545 AAACAGCATCTGGCTAGCCTTGG + Intronic
1055872744 9:80903379-80903401 AAACAGCAGCTAGAAATCATAGG + Intergenic
1056633019 9:88308932-88308954 AAGCACCATCTGAAAATCCTGGG - Intergenic
1057237237 9:93371499-93371521 CAGCAGCATCTGCACCTCCTGGG - Intergenic
1058632646 9:107005657-107005679 AAACAGCTTCTGCACAGCCAAGG - Intronic
1061356263 9:130107621-130107643 AGACAGCATCTTGACACCATAGG - Intronic
1062468777 9:136692973-136692995 CGAGAGCCTCTGGACATCCTGGG + Intergenic
1187371995 X:18717018-18717040 CATCAGCATCTTGACATGCTCGG + Intronic
1187621630 X:21062715-21062737 CAATAGCATCTTGACATTCTTGG - Intergenic
1188028072 X:25232240-25232262 AAACAGCTTCTGCACAGCCAAGG + Intergenic
1188671565 X:32887884-32887906 AAACAGCTTCTGCACAGCCAAGG + Intronic
1194644580 X:96443346-96443368 AGACAGAATTTGGACCTCCTGGG - Intergenic
1194957734 X:100200571-100200593 AAACAGCATCTAGATGTACTTGG - Intergenic
1198781338 X:140239274-140239296 AAACAGCTTCTGCACAGCCAAGG - Intergenic
1199903444 X:152200331-152200353 AAGCACCATCTGGTCATCCAAGG + Intronic
1199906988 X:152242430-152242452 AAAAAGCTTCTGCACATCCAAGG + Intronic
1201738350 Y:17296168-17296190 AATCAAGACCTGGACATCCTAGG + Intergenic