ID: 1142875467

View in Genome Browser
Species Human (GRCh38)
Location 17:2849608-2849630
Sequence CTCCAAAGGCTGAGGGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 409}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142875467_1142875474 -9 Left 1142875467 17:2849608-2849630 CCAGGCCCCCTCAGCCTTTGGAG 0: 1
1: 0
2: 2
3: 38
4: 409
Right 1142875474 17:2849622-2849644 CCTTTGGAGTTCCCCTGGACTGG 0: 1
1: 0
2: 0
3: 10
4: 97
1142875467_1142875481 19 Left 1142875467 17:2849608-2849630 CCAGGCCCCCTCAGCCTTTGGAG 0: 1
1: 0
2: 2
3: 38
4: 409
Right 1142875481 17:2849650-2849672 AGACCTGGGCTGGCAGCTGCCGG 0: 1
1: 0
2: 8
3: 56
4: 487
1142875467_1142875480 9 Left 1142875467 17:2849608-2849630 CCAGGCCCCCTCAGCCTTTGGAG 0: 1
1: 0
2: 2
3: 38
4: 409
Right 1142875480 17:2849640-2849662 ACTGGAAGAGAGACCTGGGCTGG 0: 1
1: 0
2: 2
3: 49
4: 402
1142875467_1142875479 5 Left 1142875467 17:2849608-2849630 CCAGGCCCCCTCAGCCTTTGGAG 0: 1
1: 0
2: 2
3: 38
4: 409
Right 1142875479 17:2849636-2849658 CTGGACTGGAAGAGAGACCTGGG 0: 1
1: 0
2: 1
3: 36
4: 275
1142875467_1142875482 20 Left 1142875467 17:2849608-2849630 CCAGGCCCCCTCAGCCTTTGGAG 0: 1
1: 0
2: 2
3: 38
4: 409
Right 1142875482 17:2849651-2849673 GACCTGGGCTGGCAGCTGCCGGG 0: 1
1: 1
2: 7
3: 66
4: 478
1142875467_1142875478 4 Left 1142875467 17:2849608-2849630 CCAGGCCCCCTCAGCCTTTGGAG 0: 1
1: 0
2: 2
3: 38
4: 409
Right 1142875478 17:2849635-2849657 CCTGGACTGGAAGAGAGACCTGG 0: 1
1: 0
2: 1
3: 32
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142875467 Original CRISPR CTCCAAAGGCTGAGGGGGCC TGG (reversed) Intronic
900415462 1:2532581-2532603 CTCCAAAGCCTGCGGGAGCAGGG - Intergenic
900624407 1:3601584-3601606 CTGGGCAGGCTGAGGGGGCCAGG - Intronic
900802398 1:4745485-4745507 CTCCACAGAAGGAGGGGGCCTGG + Intronic
901295173 1:8155841-8155863 CTCCAAGGGCTGAGGAGCCACGG + Intergenic
901453140 1:9348408-9348430 CTCTGAAGGCTGAGGGAGCCTGG - Intronic
901731049 1:11279989-11280011 ATCAAAAGGCTGTGGTGGCCTGG + Intronic
901915763 1:12498693-12498715 TTCTAAAGGCTGAGAGGTCCAGG + Intronic
902225841 1:14996060-14996082 CTCCAGAGGCAGAAGGGGCTGGG - Intronic
902983066 1:20139353-20139375 CTCCAGAGGCTGCGGGGAGCAGG - Exonic
903119460 1:21205597-21205619 ATCCAAAGGCTTAGGGGGGTTGG + Intergenic
903320733 1:22541655-22541677 CTGCCCAGGCTGTGGGGGCCTGG - Intergenic
903543287 1:24108577-24108599 CTCCATGGCCTGGGGGGGCCGGG + Exonic
903605633 1:24573164-24573186 CCCTGAAGGCTGATGGGGCCTGG - Intronic
903773228 1:25777269-25777291 CTCCATGGGCTGGTGGGGCCTGG - Intronic
903920140 1:26794169-26794191 CCACAAAGCCTGAGGGGGCCAGG - Exonic
904286126 1:29454192-29454214 CTGCAAAGGGTGAGGGGGTCTGG + Intergenic
904568936 1:31446149-31446171 TTGCAAAGGCTGAGGGGAGCGGG - Intergenic
904909900 1:33927027-33927049 CCACAGAGGCTGAGGGGTCCTGG - Intronic
905186589 1:36201527-36201549 CTCCAAAGGCTGAGTGAGCCAGG - Intergenic
905861228 1:41353337-41353359 CTCAGAAGGCTGAGGTGGGCCGG - Intergenic
906824249 1:48961788-48961810 TTCCAGAGGCTAAGGAGGCCTGG + Intronic
907091625 1:51730146-51730168 CTCCCAAGGAAGAGGGGCCCGGG - Intronic
907396721 1:54195770-54195792 CTCCAAAGCCTGCAGGTGCCAGG + Intronic
907438137 1:54462497-54462519 CTCCACAAGCTGGGGGGGCAGGG - Intergenic
907475107 1:54700276-54700298 CTTCCCAGGCTGAGGGGGGCAGG - Intronic
908238380 1:62168850-62168872 CTCCAGAGGCTGAGGGTGGGAGG + Intergenic
909402232 1:75247086-75247108 CTGCAAAGGATAAGGGGGCAAGG + Intronic
910173576 1:84403892-84403914 CTCCAGAGGCTGAGGTGGGAGGG - Intronic
910639239 1:89441984-89442006 CTCCAAAGGCTTAGGGAGATTGG - Intergenic
910948159 1:92616138-92616160 ATCCAAAGGCTTAGGGAGACTGG + Intronic
911625093 1:100114608-100114630 CTCCAAAGACTGAGGTGGGAGGG + Intronic
911935248 1:103961135-103961157 CTTCCAAGCCTGAGGGGGCAAGG + Intergenic
914217205 1:145642919-145642941 CTCCACAGACTGAGAGGACCAGG + Intronic
914469775 1:147965599-147965621 CTCCACAGACTGAGAGGACCAGG + Intronic
914755276 1:150558697-150558719 CTGGAAAGGCTGAGGTGTCCTGG - Intronic
914947238 1:152078626-152078648 TTACAAACGGTGAGGGGGCCGGG + Intergenic
915300252 1:154947605-154947627 CTCCAGAGGCAGGTGGGGCCTGG - Intronic
915521678 1:156448874-156448896 CTCTAAAGTCTGATGGGGACTGG + Intergenic
915667935 1:157461675-157461697 ATCCAAAGGCTTAGGGAGACTGG - Intergenic
916115100 1:161479344-161479366 GCCCAAAGGCTGAGGGGTGCGGG + Intergenic
916707316 1:167364680-167364702 CTCCAGAGGCTGAGGGAGAATGG - Intronic
917452875 1:175161802-175161824 CTCCCAAGGCTGAGAGAACCAGG + Intronic
917481945 1:175419826-175419848 CTGCAAAGGCTGAGGGAGAAAGG - Intronic
917968008 1:180190635-180190657 CTCCAAGGGGAGAGGGGGCAGGG + Intronic
920197153 1:204236339-204236361 ATCCAAAGGCTCAGGGAGACTGG + Intronic
920665905 1:207963009-207963031 CTCCAAGAGCTGGGGGTGCCAGG + Intergenic
920865851 1:209752843-209752865 CTCCAGAGGCTGAGGCACCCGGG + Intergenic
921418685 1:214921008-214921030 CTTCAGAGACTGAGGAGGCCAGG + Intergenic
921838846 1:219807000-219807022 CTCAAAATGCTGAGTGGGTCAGG - Intronic
922809397 1:228407303-228407325 CTGCCAAGGCTGTGAGGGCCGGG - Intergenic
1062806554 10:424657-424679 CTTAAAAGGCAGAGTGGGCCAGG - Intronic
1066191620 10:33061255-33061277 CTCGAGAGGCTGAGGCGGGCGGG - Intergenic
1066783695 10:38979387-38979409 CTCAAACTGCTGAGGGGTCCTGG + Intergenic
1069642830 10:69967110-69967132 CTCCAAGGGCACAGGGGGGCAGG - Intergenic
1069954630 10:72042575-72042597 TTCCAAGGGCTGTGGGGGCCTGG - Intergenic
1070818249 10:79338920-79338942 CACAGAAGGCTGAGGGGACCAGG - Intergenic
1070912882 10:80133416-80133438 CTCCAAAGGATGAGTGACCCAGG + Intronic
1071529839 10:86380736-86380758 CTGCAAAGGCAGAGAGGGCAGGG - Intergenic
1072519504 10:96218584-96218606 CTCCAGAGGCTGAGGTGGGAAGG + Intronic
1072565384 10:96612709-96612731 CATCAAAGGCTGATGGGGGCTGG + Intronic
1072737438 10:97888692-97888714 CTGCACGGGCTGAGGGGGACTGG + Intronic
1072797131 10:98364640-98364662 CACCAAAGGGTGTGGGGGCAGGG + Intergenic
1073250438 10:102117737-102117759 AGCAAGAGGCTGAGGGGGCCAGG - Intronic
1073423093 10:103440166-103440188 CTCCCAAGGCAGATGGGGGCAGG + Intronic
1073458541 10:103652324-103652346 CTGCAAAGTCTGGGGGAGCCAGG - Intronic
1074198572 10:111210468-111210490 CTCCAGAGGCTGAGGCGGGTGGG + Intergenic
1074440955 10:113477012-113477034 CCCAGAAGGCTGAGGGGGCCCGG - Intergenic
1077222867 11:1425151-1425173 CTCCAAGTGCTGAGAGCGCCGGG - Intronic
1078657848 11:13259023-13259045 CTCCCCAGGCTGAGGGAGGCAGG + Intergenic
1081291742 11:41334741-41334763 CTCCAGAGACTGAGGTGGCAGGG + Intronic
1082671429 11:56041014-56041036 ATCCAAAGGCTTAGGGAGACTGG + Intergenic
1083160341 11:60850457-60850479 CTTCAAAGGCCGAGGAGCCCCGG - Exonic
1083181314 11:60987642-60987664 CTCCAGAGGATGAGTGGGCTAGG - Intronic
1083212289 11:61195665-61195687 CAGAAAAGGCTGAGGAGGCCAGG + Intergenic
1083296960 11:61720122-61720144 CTGCAGAGGCTCAGTGGGCCTGG - Exonic
1083342654 11:61968298-61968320 CAACAAAGGCTGGGCGGGCCGGG + Intergenic
1083629382 11:64087947-64087969 CTCGAACAGCTGAGGAGGCCCGG - Intronic
1083649133 11:64190890-64190912 CTTAAAAGGCTGAGTTGGCCGGG + Intronic
1084431242 11:69112527-69112549 CACCAGAGCCTGAGGGAGCCAGG - Intergenic
1084645095 11:70452037-70452059 CTCAAGAGGCTGAGGTGGCCGGG - Intergenic
1084710836 11:70842904-70842926 CTCCACAGGCTCAGGGGGCCGGG + Intronic
1085794505 11:79525669-79525691 TGCCAAAGGCTGAGGGGGAGGGG - Intergenic
1086441943 11:86836805-86836827 GTCCAAACTCTGAGGGTGCCCGG - Intronic
1087153805 11:94882004-94882026 CTCCAAATGCCGAGGGTGGCGGG - Intergenic
1087241710 11:95789138-95789160 CCCCAGACGCTGACGGGGCCCGG + Intronic
1088482989 11:110313608-110313630 CTCAAGAGGCTGAGGTGGGCCGG + Intergenic
1088527114 11:110768898-110768920 CTCTGAAGGCTGAGTGGGACTGG + Intergenic
1088910036 11:114183782-114183804 CTCCAAGAGCAGAGTGGGCCTGG - Intronic
1089185591 11:116612511-116612533 CAGCAAAGGTTGAGGGGTCCAGG + Intergenic
1089662532 11:119994621-119994643 CTACAAAGACTGAGGGGTCGAGG + Intergenic
1089686890 11:120156593-120156615 AACCAGAGGCTGTGGGGGCCAGG - Intronic
1090362948 11:126186082-126186104 CTTCAAAGGCTGAGGAGGCAGGG + Intergenic
1091051468 11:132376704-132376726 ATCCAAAGGCTTAGGGAGACTGG + Intergenic
1091106350 11:132922964-132922986 CTCCAAAGGCTGAGGTGGGAGGG + Intronic
1091514756 12:1168002-1168024 GCCCAAAGGCTGACGGGGCGCGG - Intronic
1094537411 12:31334474-31334496 CTCCAGAGGCTGAGGTGGAAGGG - Intergenic
1096202506 12:49695091-49695113 CTCCAAAGGATGAGGTGGGAGGG + Intronic
1096453991 12:51770332-51770354 CTGCAAAGGCTAATGGGGCAAGG - Intronic
1096496046 12:52040036-52040058 AACCAAAGGCTGAGTGGGCTTGG - Intronic
1096541657 12:52311215-52311237 CTCCAAAAGCTGAAGGAGCTTGG - Intergenic
1097076594 12:56399452-56399474 ATCCAAAGGCTTAGGGAGACTGG + Intergenic
1099972280 12:89512646-89512668 CTCCAGAGGCTGAGGGAGGCGGG + Intronic
1102096716 12:110246998-110247020 CTCCATAAGGTGAAGGGGCCAGG + Intergenic
1103700289 12:122845689-122845711 CTCCACTGTCTGAGGGTGCCCGG + Intronic
1104230922 12:126883243-126883265 CTCCAAAGGGAGAGGGTGCCTGG + Intergenic
1105287274 13:19014622-19014644 CTCCAGAGGCTTAGGTGGGCAGG - Intergenic
1105481331 13:20779504-20779526 CTCCAATTGCTGGGAGGGCCTGG + Exonic
1105696785 13:22897406-22897428 CTGCGGAGGCTGTGGGGGCCCGG + Intergenic
1105701918 13:22940471-22940493 CTCCACAGGCTGGGGAGCCCGGG - Intergenic
1105854550 13:24362277-24362299 CTCCACAGGCTGGGGAGCCCGGG - Intergenic
1106409148 13:29498995-29499017 CTCACAAGGCAGAAGGGGCCAGG + Intronic
1107980821 13:45732634-45732656 CTCGAAAGGCTGAGGTGGGCTGG - Intergenic
1108245575 13:48509576-48509598 CTCCCAATTCTGAAGGGGCCAGG + Intronic
1109125923 13:58516691-58516713 CTCCAAAGGCTAAGGTGGGAGGG + Intergenic
1109780436 13:67104399-67104421 CTCCAAAGGCTTGGGTGGGCGGG - Intronic
1110626352 13:77660086-77660108 TTACAAACGGTGAGGGGGCCGGG + Intergenic
1112299126 13:98214079-98214101 CTCCAGCTGCTGAGGGGCCCAGG - Intronic
1112634614 13:101201345-101201367 TTCCAAAGGCTGAGGGAGGGAGG - Intronic
1113738163 13:112692354-112692376 CTCCAAAGGGTGAGCCGGGCTGG - Intronic
1114046587 14:18881328-18881350 CTCCAAAGGGTGAGTGACCCAGG + Intergenic
1114117624 14:19638119-19638141 CTCCAAAGGGTGAGTGACCCAGG - Intergenic
1115397159 14:32921322-32921344 CTCCAAAGTCTGAGGGTCACTGG - Intergenic
1117215167 14:53544121-53544143 CTCCAAAGGTTGAGTTGGCTCGG - Intergenic
1118305547 14:64652051-64652073 TCCCATAGGCTGAGGTGGCCTGG + Intergenic
1118385718 14:65254169-65254191 CTTCACAGGCTGGGGGGACCAGG + Intergenic
1119524896 14:75315065-75315087 CTCAAAAGGCACAGGGGGCTGGG - Intergenic
1119543982 14:75458835-75458857 CACTCAAGGCTGAGAGGGCCTGG + Intronic
1119693956 14:76697951-76697973 CTCCAAAGTCAGAGTGGGTCTGG + Intergenic
1120684969 14:87527734-87527756 CTCATAAGGCGGAAGGGGCCAGG + Intergenic
1121164162 14:91775825-91775847 CCCCAGAGGTTGAGGGGGCTTGG - Intronic
1121711817 14:96044077-96044099 CTGCAAGAGCTGGGGGGGCCAGG + Intronic
1121775917 14:96590777-96590799 CTCCAAAGGGTGTGGGGGAAAGG + Intergenic
1121884371 14:97529720-97529742 CTCCAAAGGCTGAAGAAGCTGGG + Intergenic
1122151746 14:99729584-99729606 CTCCAGAGGCTGAGGAACCCAGG - Intergenic
1122604332 14:102938271-102938293 CCCCCAGGGCTGCGGGGGCCAGG + Intronic
1122719080 14:103712225-103712247 ACCCACAGGCTGTGGGGGCCCGG - Intronic
1122820535 14:104342609-104342631 CTGCAGAGGCTGAGGGGAGCAGG + Intergenic
1125511182 15:40293243-40293265 AGCCCAAGGCTGAGGGGGCCTGG + Intronic
1125756655 15:42069761-42069783 CTCCAAGGCCTGAGTGGGCCTGG + Intronic
1126104402 15:45138199-45138221 CTACAAAGTCTGAGGTGACCAGG + Intronic
1128563772 15:68685619-68685641 CTCCATAGCCTGCTGGGGCCTGG - Intronic
1129618186 15:77117246-77117268 CTCCAAGGGCTTGGGAGGCCTGG + Intronic
1131611328 15:93967545-93967567 CTCCAGAGGCTGAGGTGGGAGGG - Intergenic
1131956617 15:97742805-97742827 CTCCAAAGCCTTAGGAAGCCTGG + Intergenic
1131979422 15:97980625-97980647 CTCCACAGGCTGACGATGCCTGG - Intergenic
1132891524 16:2207130-2207152 CTCCAAAGTCCCAGGGTGCCTGG - Intronic
1133115317 16:3575247-3575269 CCCCAAAGGCTGATGGGGGCTGG + Intronic
1133233566 16:4377517-4377539 CTCCAGAGGGTGAGGGGGCAGGG + Intronic
1134133825 16:11667335-11667357 CTCACGAGGCTGAGGTGGCCAGG - Intergenic
1136398364 16:30005056-30005078 CTCGAGGGGCTGAGGGGGGCAGG + Intronic
1136580220 16:31147143-31147165 CTGCAAAGGCTGCTGTGGCCCGG - Intronic
1138481410 16:57305745-57305767 GGCCAAAGGCTTAGGGGGCATGG - Intergenic
1138829164 16:60357887-60357909 TTACAAAGGGTGAGGGGGCTGGG + Intergenic
1139521870 16:67487425-67487447 CTCCAGAGGCTGAGGTGGGGAGG + Intergenic
1141956270 16:87373638-87373660 CTCCGGAGGCTGAGGGAGGCTGG - Intronic
1141983341 16:87563275-87563297 CTGCAAAGGCTTTGTGGGCCCGG - Intergenic
1142022802 16:87794754-87794776 TTCCAAAGCGTGAGGGGACCTGG + Intergenic
1142875467 17:2849608-2849630 CTCCAAAGGCTGAGGGGGCCTGG - Intronic
1143041517 17:4041056-4041078 CTCCAAAGGTTGGGGAGGGCAGG + Intronic
1143177418 17:4964179-4964201 CTCCAGAGGCAGAGGGGATCTGG - Intronic
1145245894 17:21269087-21269109 CTCCATCGCCTGAGAGGGCCTGG + Intergenic
1145963855 17:28903055-28903077 CTCCGAAGGCGGAGGCGGGCAGG + Exonic
1146410967 17:32584592-32584614 CTCCAAAGGCTGAGGCAGGCAGG - Intronic
1146669875 17:34729720-34729742 GTATAAAGACTGAGGGGGCCGGG + Intergenic
1147962558 17:44177044-44177066 TGCCAACGGCTGCGGGGGCCTGG + Exonic
1148060686 17:44834170-44834192 CTCCAGAGGCTGAGGTGGTGAGG + Intergenic
1148845195 17:50525945-50525967 CCGCCAAGGCTGAGGAGGCCAGG + Exonic
1149510740 17:57239347-57239369 CTTGAAAGAGTGAGGGGGCCAGG + Intergenic
1149593957 17:57852382-57852404 CGCCCAAGGCTGTGAGGGCCTGG + Intergenic
1151670042 17:75567058-75567080 CTCCAAGGCTTGAGGGTGCCCGG - Intronic
1151697330 17:75724243-75724265 CACCAAAGGGTAAGTGGGCCAGG + Intronic
1152905536 17:82968656-82968678 CGCCTAAGGCTGAGGGTGCCTGG + Intronic
1153948813 18:10039815-10039837 CTCCAGCTGCTGAGGAGGCCTGG - Intergenic
1153954238 18:10082733-10082755 CTCCAAAGGCTGTGGGAGAGTGG + Intergenic
1155073286 18:22334640-22334662 CTCCAAAGGACTATGGGGCCGGG - Intergenic
1155519351 18:26653374-26653396 ATCTAAAGGATGAAGGGGCCTGG - Intronic
1156507636 18:37608509-37608531 CTTCAGAGGCTGAGGGAGCTGGG + Intergenic
1156538520 18:37887234-37887256 CTAGAAAGGTTAAGGGGGCCAGG - Intergenic
1158333932 18:56394225-56394247 ATCCAAGGGCTGAAGGAGCCGGG - Intergenic
1158733714 18:60055481-60055503 CTCAAAAGGATGGTGGGGCCGGG + Intergenic
1160113517 18:76056104-76056126 CTCATATTGCTGAGGGGGCCAGG + Intergenic
1160388835 18:78515062-78515084 CTGCAAAGGCTGTGGTTGCCTGG - Intergenic
1160584071 18:79903191-79903213 GGGCAATGGCTGAGGGGGCCGGG - Exonic
1160958606 19:1706842-1706864 CTCAAAAAGCAGAGGGGGGCCGG + Intergenic
1160963358 19:1734620-1734642 CTTGAAAGGCTGAGCGGGCGAGG - Intergenic
1160972380 19:1775433-1775455 CTCCAAGGCCTGAGGCGCCCCGG + Exonic
1161207254 19:3047397-3047419 CCCCAAACCCTGCGGGGGCCTGG + Intronic
1161533811 19:4806437-4806459 CTCCAGAGGCTGAGGTGGGAGGG - Intergenic
1162821300 19:13225154-13225176 CAGCCAAGGCTGAGGGGGCCAGG + Intronic
1162971283 19:14182820-14182842 CTCCAAAGGTTGAAGGGACACGG - Intronic
1165103326 19:33453204-33453226 CTCCAGAGGCTGAGGGGGGAAGG + Intronic
1165735118 19:38170823-38170845 CTGCCAAGGATGAGGGGGACAGG + Intronic
1166368051 19:42287111-42287133 CCCCAAAGGGTGTGGGGGTCCGG - Exonic
1166491317 19:43262810-43262832 CTACAAAGAGTGAAGGGGCCAGG + Intronic
1166745712 19:45140967-45140989 CTCCCAAGGCTGAGGAGGTGAGG - Intronic
1167456305 19:49597958-49597980 GTCGAAAGGCTGAGGAGGCAGGG + Exonic
1167756345 19:51415808-51415830 GTCCCAGAGCTGAGGGGGCCTGG - Intronic
1167956707 19:53071253-53071275 CTCAAGAGGCTGAGGGTGCTGGG + Intronic
1168088200 19:54063822-54063844 CTTCAAAGGCGGAGCGGGACTGG + Exonic
1168527946 19:57103706-57103728 CCCCAAATGCTGAGGGTGCCAGG - Intergenic
1168685430 19:58346821-58346843 CTCCCAGGGCTGAGTGGGCTGGG - Intronic
925082539 2:1081551-1081573 CTGCAAAGGGCCAGGGGGCCTGG + Intronic
925083821 2:1091915-1091937 CTAAATAGGCTGAGGGAGCCTGG - Intronic
925610010 2:5694433-5694455 CAACAAAGGCAGAGGGGGCGGGG + Exonic
925919367 2:8628468-8628490 CTCCCAGGGCTGACTGGGCCAGG + Intergenic
926903789 2:17786956-17786978 CTCACAAGGCTGAGGCAGCCTGG + Exonic
929183541 2:39069265-39069287 CTCCAGAGGCTGAGGTGACGTGG + Intronic
929557913 2:42936954-42936976 CTCCAAAGCATGAGGGGCCCAGG - Intergenic
929694889 2:44106098-44106120 CTCCAAAGGCAGAGGGCTGCTGG + Intergenic
930957120 2:57216893-57216915 CTCCAAAGGAACAGGAGGCCTGG - Intergenic
931197308 2:60064634-60064656 CTCCAAAAGCAAAGGGGGCCAGG + Intergenic
931263224 2:60638290-60638312 TCCCCCAGGCTGAGGGGGCCAGG + Intergenic
932187857 2:69714199-69714221 CTCCAGTGGCTGGGTGGGCCGGG + Intronic
932597506 2:73103236-73103258 CTCCAAAGGTTGCTGGTGCCAGG - Intronic
932878129 2:75474374-75474396 CTTCAGAGGCTGAGGTGGGCGGG + Intronic
933707637 2:85303901-85303923 CTCGGATGGGTGAGGGGGCCGGG - Exonic
934613617 2:95758103-95758125 CTCCAAAGGGTAAGGGGCTCAGG - Intergenic
934840655 2:97622132-97622154 CTCCAAAGGGTAAGGGGCTCAGG + Intergenic
935544473 2:104386414-104386436 CTCCAGAGGCTGAGGCGGTAGGG - Intergenic
936080950 2:109432246-109432268 CTCCTAAGGCTGTGGGTGACAGG + Intronic
936151966 2:110026988-110027010 CTCCCAAGGCAGAAGGAGCCTGG + Intergenic
936154241 2:110037721-110037743 CTCCTAAGGCTCAGGCGGGCTGG - Intergenic
936190443 2:110333694-110333716 CTCCTAAGGCTCAGGCGGGCTGG + Intergenic
936192712 2:110344425-110344447 CTCCCAAGGCAGAAGGAGCCTGG - Intergenic
937800068 2:126072707-126072729 ATCCAAAGGCTTAGGGAGACTGG + Intergenic
938266770 2:129933574-129933596 CTCCAAAGGGTGAGTGACCCAGG - Intergenic
938367916 2:130749709-130749731 CTCTAAAGAATGAGGGGGGCTGG - Intergenic
938745626 2:134275688-134275710 CTCAGAAGGCTGAGGCGGCAGGG - Intronic
939575157 2:143886912-143886934 CCCCAAAGGTTGAGGGGGAGTGG - Intergenic
939985618 2:148827104-148827126 CACCACAGGCTGAGGAGGCAAGG + Intergenic
941489964 2:166131282-166131304 CTAAACAGGCTGAGGGGGCATGG + Intergenic
941670130 2:168284069-168284091 TTCCCAAGGCAGAGGGAGCCTGG + Intergenic
943964784 2:194319592-194319614 CTACAAAGGTTGAGGTGCCCTGG + Intergenic
945641903 2:212441811-212441833 ATCCAAAGGCTTAGGGAGACTGG + Intronic
946128605 2:217586524-217586546 TTCCCAGGGCTGAGGGGGCAAGG - Intronic
946756208 2:222950497-222950519 CTACAAAGGCTCAGAGGGACGGG - Intergenic
947857401 2:233333443-233333465 CCCCAAAGGCTGGAGGAGCCTGG + Intronic
947952533 2:234160611-234160633 CTCCAATGTTGGAGGGGGCCTGG - Intergenic
948692726 2:239717041-239717063 CTCCAAAGCCTGGGATGGCCTGG - Intergenic
948715533 2:239858675-239858697 CTCCAAAGGCAGTGGGTGCAGGG - Intergenic
948875751 2:240826967-240826989 CCCCAGAGGCTGAGGGGGTGGGG - Intergenic
1168972846 20:1942656-1942678 CATCAAAGGTTGAGGGGGACAGG - Intergenic
1170126631 20:12970861-12970883 CTCATAAGGCTGGGGGTGCCTGG - Intergenic
1170602980 20:17855797-17855819 CTCCAGAGGCTGAGGTGGGAGGG + Intergenic
1170611940 20:17921631-17921653 CTCCAGAGGCTGAGGTGGGAGGG + Intergenic
1172226922 20:33311294-33311316 CCCCAAAGGGTGAGGAAGCCAGG - Intergenic
1172931801 20:38591721-38591743 CTCCCCAGGCTGAGGGGCGCAGG + Intergenic
1173539805 20:43842874-43842896 CTCAAATGTCTGAGGGGCCCAGG + Intergenic
1174339905 20:49889086-49889108 CTGAGATGGCTGAGGGGGCCAGG - Exonic
1174364568 20:50048649-50048671 GCCCCAAGGCTGAGGGGGCTGGG + Intergenic
1175191816 20:57216623-57216645 CTCCTGAGGGTGAGGGGGCTGGG + Intronic
1175826178 20:61937766-61937788 GACCAAAGGCAGAGGGGACCTGG - Exonic
1177505879 21:22016558-22016580 ATCCAAAGGCTTAGGGAGCTTGG - Intergenic
1178888434 21:36500286-36500308 CTGCAAAGTCTGAGGTGGCCTGG - Intronic
1179593453 21:42426966-42426988 CTCCCAGGTCTGAGGGTGCCGGG + Intronic
1179906871 21:44427132-44427154 CCCCAAAGGCTGACGGGGCGGGG - Intronic
1180465126 22:15603967-15603989 CTCCAAAGGGTGAGTGACCCAGG + Intergenic
1180784674 22:18540143-18540165 TTCCTGAGGCTGAGGGGCCCGGG - Intergenic
1180968012 22:19800608-19800630 CTCCTAAGGCTTAGCAGGCCTGG - Intronic
1181128252 22:20714195-20714217 TTCCTGAGGCTGAGGGGCCCGGG - Intronic
1181241577 22:21479500-21479522 TTCCTGAGGCTGAGGGGCCCGGG - Intergenic
1181476559 22:23171418-23171440 CTCCAGAGGCTGAGGTGGGAGGG - Intergenic
1182444092 22:30380237-30380259 GTCCAAGGGCTGAGGGTGCTGGG + Intronic
1182743618 22:32587618-32587640 CTCCAAAGGCCGACCAGGCCCGG + Intronic
1183432612 22:37774799-37774821 CTTCAAAGTCTGAGGAGCCCTGG + Exonic
1183485714 22:38086667-38086689 CTCCAGGGGCTGAAGGGGGCTGG + Intronic
1183580786 22:38725432-38725454 CTCTGAAGGGTGAGAGGGCCTGG + Intronic
1183623881 22:38990095-38990117 CAGGAAAGGCTGAGGGGGCCAGG + Intronic
1183741346 22:39670294-39670316 CTCCAAAGGCTCAGGAGGCTGGG - Intronic
1184116403 22:42425265-42425287 TTTCAAAGGCTGAGGGAGACTGG - Intronic
1184152848 22:42648690-42648712 CTCCCAATGCTCAGTGGGCCAGG - Intronic
1184696661 22:46143195-46143217 CTCCAAAGTCTCAGGGAGCCAGG + Intergenic
1184920217 22:47600655-47600677 GTGCAGAGGCTGAGGGGGCAGGG - Intergenic
1185133168 22:49052105-49052127 CTCCAGAGTCTGCCGGGGCCGGG - Intergenic
949903492 3:8839040-8839062 CTCCACAGTCGGAGTGGGCCAGG + Intronic
950148323 3:10667370-10667392 CTCTGGAGGCTGAGGGGGCTGGG + Intronic
950221722 3:11201368-11201390 CTCCAAAGTCTGAAAGGGCACGG + Intronic
950506797 3:13400053-13400075 CTCCACAAGCTGAGGGCTCCAGG + Intronic
950647153 3:14383880-14383902 CTCCAAAGGTGGCAGGGGCCTGG + Intergenic
951213389 3:20000089-20000111 TTCCAAAGCCTGAGGAGGCTGGG - Intronic
952898743 3:38096046-38096068 CCCCAAAGCCTGCGGGGACCAGG - Intronic
953177947 3:40568791-40568813 CTCCAAAGGCTCAGGGGTTAGGG + Intronic
954138499 3:48593376-48593398 GCCCAAAGGCTGAAGGGGCAGGG - Exonic
954801368 3:53188958-53188980 GCCCATAGGCTGAGGCGGCCTGG + Intronic
955473626 3:59313067-59313089 CTCCAGAGGCTGAGGAGGTTGGG - Intergenic
958814649 3:98901879-98901901 CTCCAAAGGCCGAAGGGGATTGG - Intergenic
959915184 3:111808715-111808737 CTCTAAAGACTCAGGAGGCCTGG + Intronic
960934366 3:122888447-122888469 CTGCAAAGGCTCAGGGGGCTGGG - Intergenic
961049233 3:123733071-123733093 TTCCAAAGCCTGAAGTGGCCTGG - Exonic
961369400 3:126420221-126420243 CTCCAGAGGGTGAGTGGGCTCGG + Exonic
962281662 3:134057026-134057048 CTCCCAAGTCTGAGTGTGCCTGG - Intergenic
962492289 3:135906374-135906396 CTCCAGAGGCTGAGGTGGGAGGG - Intergenic
962763919 3:138543481-138543503 CTTCCAAGCCTGAGGGGGCAGGG + Intronic
962866539 3:139452125-139452147 CTCCACAGTCTCAGGGGTCCTGG - Intergenic
963453465 3:145515054-145515076 ATCCAAAGGCTTAGGAGGACTGG + Intergenic
966905461 3:184521168-184521190 CTCCAGAGGCTGAGGTGGGAGGG - Intronic
966932966 3:184687584-184687606 CCCCACAGGCTGTGGGGTCCTGG - Intergenic
967822060 3:193847476-193847498 AACCAAAGGCTGAGTGGGACTGG + Intergenic
968506112 4:972175-972197 CTCCGAAGGGGGAGGGGACCCGG + Intronic
968909717 4:3471472-3471494 CCCCCAAGGCAGAGGTGGCCCGG + Intronic
968950711 4:3690010-3690032 CTCCAAAGGATACGGCGGCCTGG + Intergenic
969435632 4:7187702-7187724 CTCCAAAACCTGGTGGGGCCAGG - Intergenic
969571219 4:8009689-8009711 CTCAAAAGGCCAAGTGGGCCAGG - Intronic
971026883 4:22597901-22597923 CTCCATATGCTGAGCGGGGCGGG - Intergenic
971154181 4:24064444-24064466 CACCACAGGCTGAGGGGGAAAGG + Intergenic
971635068 4:29047495-29047517 CCCCGCAGGCTGAGGGAGCCAGG - Intergenic
971701362 4:29981842-29981864 TTCCAGAGGCTGATGGGGTCAGG + Intergenic
972530893 4:39960375-39960397 TTCCAAAGGCTGAGGGATTCTGG + Intronic
972726685 4:41751393-41751415 CCCCAAAAGCTAAAGGGGCCTGG - Intergenic
976273264 4:83250985-83251007 CTCCAAAGGCTTAGGGCGATAGG - Intergenic
979527046 4:121728377-121728399 GACCAAAGGCTGAGGACGCCTGG - Intergenic
983184797 4:164689561-164689583 ATCCAAAGGCTTAGGGGGATTGG + Intergenic
985610359 5:884593-884615 CTCCAACAGCTGAGGGGCACAGG + Intronic
985629178 5:1005861-1005883 CTGGAATGGCTGAGGGGACCAGG + Intergenic
986006335 5:3672089-3672111 CTCCAGAGGCTGTAGGGGGCAGG + Intergenic
986261197 5:6147938-6147960 CTAAAAGGGCTGAAGGGGCCAGG - Intergenic
987379988 5:17275813-17275835 CTGCAGAGGCTGCGGGGCCCTGG - Exonic
987657385 5:20823689-20823711 ATCCAAAGGCTTAGGGAGACTGG - Intergenic
987979446 5:25062814-25062836 CTCCAGAGGCTGTGGTGGCATGG - Intergenic
988500211 5:31777480-31777502 ATCCAAGGGCTGAGGGGTGCAGG + Intronic
988569925 5:32354181-32354203 CCCCAAAGTCTTAGAGGGCCAGG - Intergenic
988612230 5:32737526-32737548 CTACCAAGGATGAGGGGGCTTGG + Intronic
988766159 5:34380257-34380279 ATCCAAAGGCTTAGGGAGACTGG + Intergenic
989457915 5:41663819-41663841 ATCCAAAGGCTTAGGGAGACTGG - Intergenic
989740267 5:44762795-44762817 CTCCAAGAGCTGAGGAGGCAAGG - Intergenic
990617274 5:57520699-57520721 ATCCATTGGCTGAGGAGGCCAGG + Intergenic
990651947 5:57910407-57910429 TTTCAGAGGCTGAGGGGGACAGG + Intergenic
991554094 5:67876056-67876078 TTCCTGAGGCTGAGGGGGCATGG - Intergenic
994291644 5:98034019-98034041 ATCCAAAGGCTTAGGGAGACTGG - Intergenic
997212494 5:132085715-132085737 CTGCAGGGGCTGACGGGGCCAGG - Intergenic
997230443 5:132238634-132238656 CTCCACTGGCTGAGGAGGCAGGG + Intronic
997341920 5:133151777-133151799 CTCCAAAGCCATATGGGGCCTGG + Intergenic
997441389 5:133911159-133911181 CACCACAGTCTGAAGGGGCCAGG + Intergenic
997892764 5:137689665-137689687 CTCCAAAGGGAGTGGGGGCAAGG + Intronic
998176751 5:139905878-139905900 CCCCAAAGGCTGAGGAGGGATGG - Intronic
998383668 5:141743546-141743568 GGCCAAGGGCTGAGGGAGCCTGG - Intergenic
998483178 5:142479830-142479852 CTTCAAAGGAAGAGGGGGGCAGG + Intergenic
999747306 5:154602177-154602199 CTCCAGAGGCTGAGGAGGGAGGG + Intergenic
1001334641 5:170787438-170787460 CTCCTGAAGCTGAGGAGGCCGGG + Intronic
1001581382 5:172800848-172800870 CTCAAAAGGCAGTGAGGGCCAGG + Intergenic
1002439566 5:179257336-179257358 CTCTCCAGGCTGCGGGGGCCTGG + Intronic
1002660404 5:180787749-180787771 CTGCCAAGGCTGAGGGGCCAGGG - Intergenic
1003049065 6:2764309-2764331 CTCCAAAGGCTAAGGCGGAAGGG + Intergenic
1003116500 6:3287077-3287099 CTCCACAGGCTGACGGGGTACGG - Exonic
1003568876 6:7242948-7242970 CCTCAAGGGCAGAGGGGGCCAGG - Intronic
1003874401 6:10423375-10423397 CGCCTAAGGCCGAGAGGGCCGGG - Intergenic
1004449034 6:15727588-15727610 TTCCAAAGGCTGAGAGTTCCTGG + Intergenic
1005522083 6:26610526-26610548 CTACGAAGCCAGAGGGGGCCGGG + Intergenic
1007380395 6:41486648-41486670 ATACAAAGGCTGAGGGAGGCAGG + Intergenic
1007635996 6:43300047-43300069 CACCAGAGGCTGAGGATGCCTGG - Exonic
1007828164 6:44617350-44617372 CACCAAAGGCGCAGGGGCCCTGG - Intergenic
1010906124 6:81491641-81491663 GTCCAAAGTCTGAGGGGACTGGG - Intronic
1011039621 6:83015304-83015326 ATCCAAAGGCTTAGGGAGACTGG - Intronic
1011745634 6:90405328-90405350 CTCCAGAGGCTGAGGCGGGAGGG - Intergenic
1011818694 6:91224518-91224540 CTCCAGAGGCTGAGGTGGGAGGG - Intergenic
1012391528 6:98746593-98746615 ATCCAAAGGCAGAGGGAGCTGGG - Intergenic
1012550731 6:100463247-100463269 TTTCAAAGGCAGAAGGGGCCGGG - Intronic
1012715225 6:102660557-102660579 CACCACAGGCTAAGGGGCCCTGG + Intergenic
1013288172 6:108698277-108698299 CACCGAGGGCTGAGGGGGACAGG - Intergenic
1015274145 6:131367124-131367146 CTCGGAAGGCTGAGGTGGCAGGG + Intergenic
1015475466 6:133655272-133655294 ATCCAAAGGCTTAGGGAGACTGG + Intergenic
1015913001 6:138187208-138187230 TTCAAAAGGATGAGAGGGCCGGG - Intronic
1016034875 6:139374802-139374824 CTGCAGAGGCTGCGGGGCCCGGG + Intergenic
1016626736 6:146179344-146179366 CTCCAAAGGCTTAGCTGGCTGGG - Intronic
1017485350 6:154897279-154897301 TTAAAAAGGCTGAGGTGGCCAGG - Intronic
1018540524 6:164874761-164874783 CTTCAAAGGCTTAGGGAGACTGG + Intergenic
1018743081 6:166744848-166744870 TTCCTAAAGCTTAGGGGGCCTGG + Intronic
1018986398 6:168640403-168640425 CTGCAGACGCTGAGGGGCCCAGG + Intronic
1019111994 6:169724163-169724185 CGCCAAAGGCTGGGAGGGCGCGG + Intronic
1019460288 7:1154555-1154577 CTCCAGAGGCTGAGGGTCCCAGG + Intronic
1023112895 7:36832101-36832123 CTAAAAATGCTGATGGGGCCAGG + Intergenic
1024556268 7:50605656-50605678 GTCCAAATGCTGCGGGTGCCGGG - Intronic
1026138750 7:67686546-67686568 CTCCAGAGGCTGAGTGAGGCAGG + Intergenic
1026893046 7:73993604-73993626 ATCCAAAGGCTGCCGGGGCGGGG + Intergenic
1026901083 7:74037889-74037911 CTCCCAAGGATGAGTAGGCCGGG + Intronic
1026910234 7:74087294-74087316 CTCAAGAGGCTGAGGTGGCAGGG + Intronic
1027827240 7:83131488-83131510 AGCCAAAGGGAGAGGGGGCCAGG + Intronic
1029064685 7:97837774-97837796 CACCTTAGGATGAGGGGGCCAGG - Intergenic
1030508686 7:110456256-110456278 ATCCAAAGGCTTAGGGAGACAGG + Intergenic
1030807773 7:113937611-113937633 CGCCAGAGTCTGTGGGGGCCAGG + Intronic
1032719859 7:134542069-134542091 CTCCGAAGGCTGAGGTGGGAGGG + Intergenic
1033233980 7:139623780-139623802 CTCCAGAGTCAGAGGGGGCTGGG - Intronic
1034179453 7:149126299-149126321 CCCCAAAGGCAGAGCCGGCCGGG + Exonic
1034487220 7:151373582-151373604 CTCCCCAGGCTGTGGGGGGCGGG + Intronic
1034788618 7:153947758-153947780 CTCCAAAGGCAGAGGCAGCCGGG - Intronic
1035133249 7:156675295-156675317 CTCCAAAGACGGAGGGAGCCGGG - Intronic
1035227366 7:157441133-157441155 TTCCAAAGGCTGAGGAAGCCAGG + Intergenic
1035683507 8:1507153-1507175 CTCCAAGGGCTGAGGAGTGCAGG - Intronic
1036767572 8:11558460-11558482 GTGCAAAGGCTGAGGGCCCCTGG - Intronic
1036782262 8:11657951-11657973 CTCCCAGGGCTGTGTGGGCCTGG - Intergenic
1036946518 8:13099779-13099801 CTCCTGAGGCTGATGTGGCCAGG + Exonic
1039339417 8:36630481-36630503 CTCTAAAGGCTGAGGTGGTCAGG + Intergenic
1039900250 8:41746719-41746741 CTGCAGAGGCTGATGGGCCCTGG + Intronic
1039979206 8:42392090-42392112 CTCCATCGCCTGAGGTGGCCCGG - Intronic
1040542892 8:48375650-48375672 CTCCAAAGGCTCACGTGACCAGG - Intergenic
1043684170 8:83066864-83066886 GTGCAAAGACTGAAGGGGCCTGG + Intergenic
1045011997 8:97966447-97966469 CTCCAGAGGCTGAGGTGGGAGGG + Intronic
1045084728 8:98670259-98670281 CTCCAGAGGCTGAGGCGAGCAGG + Intronic
1047382348 8:124374892-124374914 CTCAACAGACTGAAGGGGCCTGG - Intergenic
1048389830 8:133952199-133952221 CTGCAAAGGCTGAACTGGCCAGG + Intergenic
1048442871 8:134472748-134472770 CCCCAGAGGCTGGGGGAGCCTGG - Intergenic
1048992907 8:139771816-139771838 CCCTAAAGGCCGAGGGTGCCTGG - Intronic
1050916376 9:11139969-11139991 TACCAAAGGCTGAGGGGGCAGGG - Intergenic
1051068320 9:13131822-13131844 CTCCAAAGACTGAGGGAGCTGGG - Intronic
1051407007 9:16748403-16748425 CTCCAGAGGCTGAGGTGGGAGGG + Intronic
1052413672 9:28150144-28150166 TTACAAACGGTGAGGGGGCCAGG - Intronic
1052833979 9:33236668-33236690 CGCCAAGGGCTGAGTGGGCAGGG - Intronic
1053154758 9:35769250-35769272 CTCCCAAGTCTGACAGGGCCAGG - Intergenic
1053181093 9:35971353-35971375 CTCCTGAGGCTGAGCGGGGCAGG - Intergenic
1053308587 9:37001278-37001300 CCCCAGAGGCTGAGGGATCCAGG - Intronic
1053314625 9:37041061-37041083 CTCCTTAGGCCGAGGGGGCAGGG - Intergenic
1056019950 9:82430998-82431020 TTACAAACGGTGAGGGGGCCGGG + Intergenic
1056475672 9:86948740-86948762 CTCCAGAAGCAGAGGGAGCCGGG + Intergenic
1057071891 9:92106035-92106057 TTACAAACGGTGAGGGGGCCGGG - Intronic
1057314121 9:93958203-93958225 CTCCAGGGGCTGAGAGAGCCAGG + Intergenic
1057950302 9:99364472-99364494 GTCCAAATGCTGCAGGGGCCAGG + Intergenic
1058195166 9:101965516-101965538 ATCAAAAGGCTGAGGCTGCCAGG + Intergenic
1060870535 9:127036278-127036300 CTCCAATGGCTGACCAGGCCTGG - Intronic
1061023553 9:128032768-128032790 CTCCTGAGGCTGAGGGGGGAGGG - Intergenic
1062003017 9:134226254-134226276 CTCCAGATGCTGCTGGGGCCAGG - Intergenic
1062036409 9:134384558-134384580 CTCCACCGGCTGAGGGGCCCAGG - Intronic
1062114260 9:134799242-134799264 TTCGAAGGGCTGATGGGGCCAGG - Intronic
1062228201 9:135465749-135465771 CTCTGAGGGCTGAGGGAGCCGGG - Intergenic
1062472539 9:136712754-136712776 CTCCCCAGGCAGAGGCGGCCGGG - Intronic
1062493797 9:136822146-136822168 CTCCCAACGCAGAGGGCGCCCGG - Intronic
1062525242 9:136975636-136975658 CTCTGAAGTCTGATGGGGCCGGG - Intergenic
1062613645 9:137386621-137386643 CTCTCAAGGCTGAGGGGCCACGG - Intronic
1186096600 X:6109156-6109178 CTCCAGAGGCTGAGGGTGGAGGG + Intronic
1187109614 X:16283337-16283359 CTCCACAGGCTGGGGCAGCCTGG - Intergenic
1187604617 X:20870013-20870035 ATCCAAAGGCTTAGGGAGACAGG + Intergenic
1189446565 X:41085954-41085976 ATCGAAAGGCTGCGGCGGCCGGG - Exonic
1190056344 X:47183222-47183244 CTCAAAAGGTGGAGGGGGGCCGG + Intronic
1191659076 X:63632038-63632060 ATCCAAAGGCTTAGGGAGACTGG - Intergenic
1192050599 X:67720721-67720743 CTCCATAGGATGAGCAGGCCTGG - Intronic
1194425656 X:93734319-93734341 CTCCAGAGGCTGAGGTGGGAGGG - Intergenic
1196086840 X:111692894-111692916 CTCCAGAGGCTGAGGTGGGAGGG - Intronic
1197591597 X:128417291-128417313 ATCCAAAGGCTGAGGGAGATTGG + Intergenic
1197819523 X:130530359-130530381 CACCCAAGGCTGAGGGGGTTGGG - Intergenic
1197819547 X:130530439-130530461 CACCCAAGGCTGAGGGGGTGGGG - Intergenic
1197819573 X:130530520-130530542 CACCCAAGGCTGAGGGGGTGTGG - Intergenic
1197819640 X:130530762-130530784 CACCCAAGGCTGAGGGGGTGGGG - Intergenic
1197819716 X:130531005-130531027 CACCCAAGGCTGAGGGGGTGTGG - Intergenic
1197819809 X:130531398-130531420 CATCCAAGGCTGAGGGGGCAAGG - Intergenic
1198044430 X:132886837-132886859 TTCAAAATGCTGAGAGGGCCAGG + Intronic
1199386620 X:147230580-147230602 CTCCAGAATCTGAGGGTGCCTGG - Intergenic
1200059063 X:153476024-153476046 CCCCACAGCCTGAGGGGGGCCGG + Intronic
1200108065 X:153725329-153725351 CTCCATAGGCCGCGAGGGCCAGG - Exonic
1200124134 X:153805328-153805350 CTCTGAAGGCTGAGGGGGCTGGG - Intronic
1200908484 Y:8510030-8510052 ATCCAAAGGCTGAGTGGGGAAGG + Intergenic
1201553236 Y:15240559-15240581 CTCCAGAGGCTGAGGGGGGAGGG + Intergenic