ID: 1142881553

View in Genome Browser
Species Human (GRCh38)
Location 17:2885862-2885884
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 165}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142881553_1142881558 14 Left 1142881553 17:2885862-2885884 CCTTCCAGCATTATTGACATTGA 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1142881558 17:2885899-2885921 ACTTAGGTGACCAGGGCAGCTGG 0: 1
1: 0
2: 2
3: 18
4: 303
1142881553_1142881561 29 Left 1142881553 17:2885862-2885884 CCTTCCAGCATTATTGACATTGA 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1142881561 17:2885914-2885936 GCAGCTGGAAATGATTCGGCAGG 0: 1
1: 0
2: 1
3: 5
4: 98
1142881553_1142881555 -2 Left 1142881553 17:2885862-2885884 CCTTCCAGCATTATTGACATTGA 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1142881555 17:2885883-2885905 GATGCATCATCTTGTCACTTAGG 0: 1
1: 0
2: 2
3: 7
4: 113
1142881553_1142881560 25 Left 1142881553 17:2885862-2885884 CCTTCCAGCATTATTGACATTGA 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1142881560 17:2885910-2885932 CAGGGCAGCTGGAAATGATTCGG 0: 1
1: 0
2: 2
3: 16
4: 224
1142881553_1142881557 7 Left 1142881553 17:2885862-2885884 CCTTCCAGCATTATTGACATTGA 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1142881557 17:2885892-2885914 TCTTGTCACTTAGGTGACCAGGG 0: 1
1: 0
2: 2
3: 12
4: 112
1142881553_1142881556 6 Left 1142881553 17:2885862-2885884 CCTTCCAGCATTATTGACATTGA 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1142881556 17:2885891-2885913 ATCTTGTCACTTAGGTGACCAGG 0: 1
1: 0
2: 0
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142881553 Original CRISPR TCAATGTCAATAATGCTGGA AGG (reversed) Intronic