ID: 1142881554

View in Genome Browser
Species Human (GRCh38)
Location 17:2885866-2885888
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142881554_1142881557 3 Left 1142881554 17:2885866-2885888 CCAGCATTATTGACATTGATGCA 0: 1
1: 0
2: 2
3: 12
4: 120
Right 1142881557 17:2885892-2885914 TCTTGTCACTTAGGTGACCAGGG 0: 1
1: 0
2: 2
3: 12
4: 112
1142881554_1142881558 10 Left 1142881554 17:2885866-2885888 CCAGCATTATTGACATTGATGCA 0: 1
1: 0
2: 2
3: 12
4: 120
Right 1142881558 17:2885899-2885921 ACTTAGGTGACCAGGGCAGCTGG 0: 1
1: 0
2: 2
3: 18
4: 303
1142881554_1142881561 25 Left 1142881554 17:2885866-2885888 CCAGCATTATTGACATTGATGCA 0: 1
1: 0
2: 2
3: 12
4: 120
Right 1142881561 17:2885914-2885936 GCAGCTGGAAATGATTCGGCAGG 0: 1
1: 0
2: 1
3: 5
4: 98
1142881554_1142881562 29 Left 1142881554 17:2885866-2885888 CCAGCATTATTGACATTGATGCA 0: 1
1: 0
2: 2
3: 12
4: 120
Right 1142881562 17:2885918-2885940 CTGGAAATGATTCGGCAGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 109
1142881554_1142881556 2 Left 1142881554 17:2885866-2885888 CCAGCATTATTGACATTGATGCA 0: 1
1: 0
2: 2
3: 12
4: 120
Right 1142881556 17:2885891-2885913 ATCTTGTCACTTAGGTGACCAGG 0: 1
1: 0
2: 0
3: 5
4: 88
1142881554_1142881555 -6 Left 1142881554 17:2885866-2885888 CCAGCATTATTGACATTGATGCA 0: 1
1: 0
2: 2
3: 12
4: 120
Right 1142881555 17:2885883-2885905 GATGCATCATCTTGTCACTTAGG 0: 1
1: 0
2: 2
3: 7
4: 113
1142881554_1142881560 21 Left 1142881554 17:2885866-2885888 CCAGCATTATTGACATTGATGCA 0: 1
1: 0
2: 2
3: 12
4: 120
Right 1142881560 17:2885910-2885932 CAGGGCAGCTGGAAATGATTCGG 0: 1
1: 0
2: 2
3: 16
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142881554 Original CRISPR TGCATCAATGTCAATAATGC TGG (reversed) Intronic