ID: 1142881558

View in Genome Browser
Species Human (GRCh38)
Location 17:2885899-2885921
Sequence ACTTAGGTGACCAGGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 303}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142881554_1142881558 10 Left 1142881554 17:2885866-2885888 CCAGCATTATTGACATTGATGCA 0: 1
1: 0
2: 2
3: 12
4: 120
Right 1142881558 17:2885899-2885921 ACTTAGGTGACCAGGGCAGCTGG 0: 1
1: 0
2: 2
3: 18
4: 303
1142881552_1142881558 15 Left 1142881552 17:2885861-2885883 CCCTTCCAGCATTATTGACATTG 0: 1
1: 0
2: 1
3: 13
4: 236
Right 1142881558 17:2885899-2885921 ACTTAGGTGACCAGGGCAGCTGG 0: 1
1: 0
2: 2
3: 18
4: 303
1142881553_1142881558 14 Left 1142881553 17:2885862-2885884 CCTTCCAGCATTATTGACATTGA 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1142881558 17:2885899-2885921 ACTTAGGTGACCAGGGCAGCTGG 0: 1
1: 0
2: 2
3: 18
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142881558 Original CRISPR ACTTAGGTGACCAGGGCAGC TGG Intronic