ID: 1142881558

View in Genome Browser
Species Human (GRCh38)
Location 17:2885899-2885921
Sequence ACTTAGGTGACCAGGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 303}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142881554_1142881558 10 Left 1142881554 17:2885866-2885888 CCAGCATTATTGACATTGATGCA 0: 1
1: 0
2: 2
3: 12
4: 120
Right 1142881558 17:2885899-2885921 ACTTAGGTGACCAGGGCAGCTGG 0: 1
1: 0
2: 2
3: 18
4: 303
1142881552_1142881558 15 Left 1142881552 17:2885861-2885883 CCCTTCCAGCATTATTGACATTG 0: 1
1: 0
2: 1
3: 13
4: 236
Right 1142881558 17:2885899-2885921 ACTTAGGTGACCAGGGCAGCTGG 0: 1
1: 0
2: 2
3: 18
4: 303
1142881553_1142881558 14 Left 1142881553 17:2885862-2885884 CCTTCCAGCATTATTGACATTGA 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1142881558 17:2885899-2885921 ACTTAGGTGACCAGGGCAGCTGG 0: 1
1: 0
2: 2
3: 18
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142881558 Original CRISPR ACTTAGGTGACCAGGGCAGC TGG Intronic
900742797 1:4340911-4340933 ACTAAGGTAAACAGGGCAGCGGG - Intergenic
901503162 1:9666474-9666496 ACTTGGGAGGCCAGGGCAGGTGG - Intronic
902233748 1:15044503-15044525 GTTTAGGAGACCAGGGCAGGTGG + Intronic
903186737 1:21633470-21633492 ACTCTGGTGGCCAGGGCAGGTGG + Intronic
903261416 1:22133662-22133684 TCCTGGGTGGCCAGGGCAGCAGG - Intronic
903732561 1:25507048-25507070 ACTTAGGTAAACAAAGCAGCCGG + Intergenic
903773716 1:25779913-25779935 ACTTGGGTGACCTGGACAGGAGG + Intronic
904747003 1:32717451-32717473 ACTTCTGTGACCAGGGAAGGGGG + Intergenic
905057161 1:35105848-35105870 CCTTAGGAGACCAAGGCAGGAGG - Intronic
906369235 1:45238149-45238171 ACTTAGGAGACTAAGGCAGAAGG + Intronic
906621292 1:47282614-47282636 TGTTAGTTGACCAGGGAAGCTGG + Intronic
907424310 1:54369522-54369544 AGTTAGGTGACCGTGGCAGACGG + Intronic
907558015 1:55361813-55361835 ACTTAGGAGGCCAAGGCAGGAGG - Intergenic
909325052 1:74340753-74340775 AGTTAGGGGTCCAGGGCATCTGG - Intronic
909828408 1:80154547-80154569 ACTCAGGTGGACAGAGCAGCTGG - Intergenic
910295638 1:85642320-85642342 ACTTAGGTAAACAAAGCAGCCGG + Intergenic
910311592 1:85830464-85830486 ACTTAGGTAAACAAAGCAGCCGG - Intronic
912274831 1:108245187-108245209 ACTTAGGAGACCTGGGCTACAGG - Intergenic
912286434 1:108374605-108374627 ACTTAGGAGACCTGGGCTACAGG + Intergenic
912293387 1:108449170-108449192 ACTTAGGAGACCTGGGCTACAGG + Intronic
912853183 1:113144791-113144813 CCTTAGAGGACCAGGGCAGATGG - Intergenic
917440701 1:175066559-175066581 ACAGAGGTGACCAGTGCAGTAGG - Intergenic
918738539 1:188097684-188097706 TCTTACATGACCAGGGCAGGAGG + Intergenic
919803662 1:201368161-201368183 ACCGAGGAGACCAGGGCAGAAGG - Exonic
919938897 1:202272959-202272981 ACCTAGGTGAACAGGTGAGCAGG + Intronic
921867710 1:220104080-220104102 ACTTGGGTGGCCAGGGCAGGAGG - Intronic
922293653 1:224229938-224229960 ACTTAGGAGACCGAGGCAGAAGG - Intronic
923106315 1:230856641-230856663 CCTTGGGTGTCCAGAGCAGCTGG + Intronic
924087631 1:240469373-240469395 ACATAAATGACCTGGGCAGCTGG - Intronic
924473789 1:244366284-244366306 ACTCAGGAGACTAAGGCAGCAGG - Intronic
924719500 1:246608982-246609004 CTTTAGGTTAACAGGGCAGCTGG + Intronic
1063086336 10:2821363-2821385 ACTCAGGTGACCAGGGTGGTAGG + Intergenic
1063611503 10:7566482-7566504 ACTTAGAAGGCCAGGGCAGGTGG + Intronic
1064852408 10:19723631-19723653 ACTCAGGAGACCAAGGCAGGAGG + Intronic
1065124423 10:22560336-22560358 AGTGAGGTGGCCAGGGCGGCGGG - Intronic
1065129147 10:22602792-22602814 ACTCAGGTGGCCAGTGCAGGAGG - Intronic
1065228926 10:23576940-23576962 ATTTAGGAGACCAAGGCAGGAGG - Intergenic
1065719528 10:28613036-28613058 ACTTAGGAGGCCAAGGCAGGAGG + Intronic
1066387962 10:34956804-34956826 CCTTAGGAGGCCAAGGCAGCAGG - Intergenic
1067063654 10:43090995-43091017 AGGCAGGTGACCAGGGCAGCAGG + Intronic
1067301485 10:45014712-45014734 GCTTAGGTAAACAAGGCAGCTGG - Intergenic
1067499586 10:46790466-46790488 CCTTGGGAGACCAGGGCAGGTGG - Intergenic
1067595042 10:47549858-47549880 CCTTGGGAGACCAGGGCAGGTGG + Intergenic
1067642150 10:48057939-48057961 CCTTGGGAGACCAGGGCAGGTGG + Intergenic
1068717659 10:60206049-60206071 CCTTGGGTTCCCAGGGCAGCTGG - Intronic
1069742884 10:70696729-70696751 GGTTAGGTGAGCAGGGCAGTGGG + Intronic
1078059737 11:8035516-8035538 TCGCAGGTGCCCAGGGCAGCAGG + Intronic
1078341500 11:10500824-10500846 AGTTAGCTGCCCAGGGCAGCAGG + Intronic
1080504362 11:32897867-32897889 ACTTAGTTGCCCAGGCCAGATGG + Intronic
1080839782 11:35973111-35973133 AGGGAGGAGACCAGGGCAGCTGG - Intronic
1081695775 11:45108277-45108299 ACGTAAGAGGCCAGGGCAGCAGG - Intronic
1082282964 11:50289962-50289984 ACTTTGGGGACCAAGGCAGGAGG - Intergenic
1082783492 11:57303804-57303826 ACTTGGGAGGCCAGGGCAGGGGG + Intronic
1083649675 11:64194604-64194626 ACTTACGTGCCCAGGTCAGAAGG - Exonic
1083676405 11:64327980-64328002 ACTTTGGTGACCAAGGTTGCAGG - Intergenic
1084475567 11:69386780-69386802 GCCTAGGTGACCACAGCAGCTGG + Intergenic
1085063907 11:73474444-73474466 ACTTGGGAGACTAGGGCAGGAGG - Intronic
1085107638 11:73859522-73859544 ATTTGGGAGGCCAGGGCAGCTGG - Intronic
1085754771 11:79193282-79193304 AGTGAGGTGGGCAGGGCAGCCGG + Intronic
1088470443 11:110183748-110183770 ACTGAAGGGGCCAGGGCAGCAGG + Intronic
1089698708 11:120231302-120231324 ACTAAGGAGCCCAAGGCAGCTGG - Intergenic
1092722514 12:11455837-11455859 AGTTAGCTGGCCAGGGCAGAGGG + Intronic
1093491394 12:19709172-19709194 ACTCAGGAGACCAAGGCAGGAGG - Intronic
1093637851 12:21493017-21493039 ACTTATGTGATCATGGGAGCTGG - Intronic
1094556977 12:31510575-31510597 TCTTAGGTGCTAAGGGCAGCTGG - Intronic
1096132865 12:49174433-49174455 ACTTAGGTGGCCAAGGCAGGAGG - Intergenic
1096901583 12:54888548-54888570 ACTTAGGTAAACAAAGCAGCTGG - Intergenic
1098463962 12:70765484-70765506 ACTTAGGTAAACAAAGCAGCCGG + Intronic
1099815094 12:87635669-87635691 ACTTAGGAGACTGGGGCAGAAGG - Intergenic
1102346421 12:112163850-112163872 ACTGGGATGACCAGGGCGGCTGG - Intronic
1102844283 12:116161938-116161960 TCTTAGGTGACGGGGGCAGGGGG + Intronic
1103587976 12:121970339-121970361 TCTTGGCTGAGCAGGGCAGCAGG - Intronic
1105885081 13:24635073-24635095 CTTTGGGTGACCAGGGCAGGAGG + Intergenic
1106314122 13:28578575-28578597 ACTTAGAAGTCCAGTGCAGCTGG + Intergenic
1112609604 13:100943512-100943534 ACTTGGGAGGCCAGGGCAGGTGG + Intergenic
1114685417 14:24526412-24526434 GCTTAGGTAAACAAGGCAGCTGG + Intergenic
1115524526 14:34266479-34266501 ACACAGGTGTCCAGGGAAGCAGG + Intronic
1115868257 14:37772346-37772368 ACTTAGGTAAACAAAGCAGCAGG - Intronic
1117884707 14:60348418-60348440 ACAAGGGTGGCCAGGGCAGCAGG - Intergenic
1118807570 14:69251206-69251228 ACTGGGGAGACCAGGGCAGTGGG + Intergenic
1118943722 14:70362779-70362801 ACTTAGGAGGCCAAGGCAGGAGG - Intronic
1119779398 14:77268342-77268364 CCTTAGATAACCAGGGCTGCGGG - Intronic
1121144342 14:91570796-91570818 ACTTGGGAGACGAGGGCAGGAGG - Intergenic
1122240609 14:100363868-100363890 ACTTAGGAGGCCAAGGCAGGAGG - Intronic
1123009138 14:105338778-105338800 TCTAAAGTGGCCAGGGCAGCAGG + Intronic
1124486656 15:30123254-30123276 ACTCAGGAGGCCAGGGCTGCAGG + Intergenic
1125599464 15:40907384-40907406 GCTGTGGTGGCCAGGGCAGCTGG - Intergenic
1126442066 15:48700058-48700080 ACTTGGGTAACCAAGGCAGGAGG + Intergenic
1127489769 15:59451413-59451435 ACCTAGGAATCCAGGGCAGCAGG - Intronic
1128229281 15:66023725-66023747 AATTATCTGCCCAGGGCAGCAGG - Intronic
1129168164 15:73791107-73791129 ACTGAAGGGACCAGGGCTGCAGG - Intergenic
1129610867 15:77055307-77055329 ACTTAGAACACCAAGGCAGCTGG - Intronic
1129705913 15:77794131-77794153 ACTGGGGTGACAAGGGCAGGGGG - Intronic
1130558433 15:84940069-84940091 ATTTAGGAGGCCAGGGCAGAAGG - Intronic
1131036928 15:89228783-89228805 ACTTAGGAGGCCAAGGCAGAAGG + Intergenic
1131930239 15:97433156-97433178 GCTTAGGTAAACAGAGCAGCAGG + Intergenic
1132345378 15:101105067-101105089 ACTTAGGAGGCCAAGGCTGCAGG - Intergenic
1132799696 16:1745944-1745966 CTTTAAGTGACCAGGGCAGACGG - Intronic
1133114053 16:3565929-3565951 ACTTGGGAGGCCAAGGCAGCAGG + Intronic
1133399657 16:5475912-5475934 ACTTTGGAGGCCAGGGCAGGAGG - Intergenic
1134144256 16:11747348-11747370 ACTGAGGTGCCCTGGGCAGGGGG - Intergenic
1134253550 16:12592217-12592239 ACTTAGGTAAACAAAGCAGCCGG + Intergenic
1135103635 16:19628119-19628141 ACTTGGGAGGCCAGGGCAGGAGG + Intronic
1135487499 16:22878950-22878972 AGTTAGGGGAACAGGGCAGAGGG + Intronic
1136416119 16:30104870-30104892 ACTTAGGAGGTCCGGGCAGCTGG + Exonic
1138395931 16:56704604-56704626 ACTAAGGAGACCAAGGCAGGAGG + Intronic
1140437417 16:74958948-74958970 ACTCAGGAGACCAAGGCAGGAGG + Intronic
1141522005 16:84586831-84586853 CCTTGGGAGACCAAGGCAGCCGG - Intronic
1141724511 16:85778331-85778353 AGTTAGAAGTCCAGGGCAGCTGG - Intronic
1142881558 17:2885899-2885921 ACTTAGGTGACCAGGGCAGCTGG + Intronic
1143379762 17:6488734-6488756 ACTCTGGTGACAAGAGCAGCTGG + Intronic
1143868364 17:9940259-9940281 GCTGAGGTGTGCAGGGCAGCAGG - Intronic
1144117453 17:12112217-12112239 ACTTTGGAGACCAAGGCAGCTGG + Intronic
1145841597 17:27999719-27999741 ACTAAGGAGACCAGGGCAGGAGG + Intergenic
1147252662 17:39162694-39162716 ACTGAGGTGAGGAGGGCACCAGG - Exonic
1150347153 17:64412968-64412990 AGTTAGCTGACCAAGGAAGCAGG - Intronic
1150350646 17:64442003-64442025 ACTTGGGAGACCATGGCAGGAGG - Intergenic
1152977052 18:231190-231212 ATTTAGGAGACCAGGGCGGGAGG - Intronic
1153623603 18:7003124-7003146 ACTTAGGAGGCCAAGGCAGGAGG - Intronic
1153988729 18:10376373-10376395 ACTTAGGGGACCAGGCCCGATGG - Intergenic
1154258547 18:12808072-12808094 ACTTAAGAGACTAGGGCAGGAGG + Intronic
1155305978 18:24478779-24478801 ACTTGGGAGGCCAAGGCAGCAGG - Exonic
1155602434 18:27564973-27564995 ACTTGGGAGGCCAGGGCAGGCGG - Intergenic
1156753611 18:40493063-40493085 ACTTAGCAGACCAGGGGAACGGG - Intergenic
1158722550 18:59938525-59938547 CCTTAGGAGGCCAGGGCAGGTGG - Intergenic
1159602590 18:70442834-70442856 ACTTTGGAGACCAGGGCAGGGGG - Intergenic
1163536930 19:17882235-17882257 TCTCAGGAGACCAGGGCAGGGGG - Intronic
1163552480 19:17973522-17973544 ACTTAGGAGGCCAAGGCAGAAGG - Intronic
1163983038 19:20919773-20919795 ACTCAGGTGTCTAGGGCAGGAGG - Intergenic
1164071195 19:21769782-21769804 ACTTAGGTGGCCGAGGCAGGAGG + Intergenic
1165563608 19:36703597-36703619 ACTTAGGTAAACAAAGCAGCCGG - Intronic
1165775186 19:38400197-38400219 ACTTGGGAGACCAAGGCAGGTGG - Intergenic
1165908345 19:39207598-39207620 ACTTAGGAGGCCAAGGCAGGAGG + Intergenic
1166423524 19:42656123-42656145 ACTAAGCTTCCCAGGGCAGCTGG - Intronic
1166436859 19:42774629-42774651 ACTTAGGTAAACAAAGCAGCTGG - Intronic
1167042745 19:47032295-47032317 ACTTCGGAGACCAGCGCTGCGGG - Exonic
928426865 2:31186422-31186444 ACTTACTTGACCAGGTCATCTGG + Exonic
929773473 2:44912836-44912858 ACTTAGGTGCCCAGGGGAACGGG - Intergenic
930987604 2:57609299-57609321 GCTTAGGTGAACAAAGCAGCAGG + Intergenic
931246693 2:60498208-60498230 ACTTCTGTGCCCAGGGCTGCTGG - Intronic
931482022 2:62651258-62651280 GCTTAGGTGAACAAAGCAGCTGG - Intergenic
932250160 2:70236567-70236589 ACTCAGGGGACCAAGGCAGTAGG - Intronic
934579819 2:95428922-95428944 ACTTGGGAGACCAAGGCAGGAGG + Intergenic
934599628 2:95647803-95647825 ACTTGGGAGACCAAGGCAGGAGG - Intergenic
935266031 2:101395034-101395056 ACTTGGGAGGCCAAGGCAGCTGG - Intergenic
936532968 2:113289806-113289828 ACTTGGGAGACCAAGGCAGGAGG - Intergenic
938295582 2:130176932-130176954 ACTTAGGAGGCCAAGGCAGGAGG - Intronic
938697760 2:133849970-133849992 ATTTGGGAGACCAGGGCAGGAGG - Intergenic
938846771 2:135217919-135217941 ACTCAGGAGACTAAGGCAGCAGG - Intronic
939687309 2:145215125-145215147 ACTTAGATGACCAGAGCAGGAGG + Intergenic
944059568 2:195558101-195558123 ACTTAGGAGACAAAGGCAGGAGG + Intergenic
945313735 2:208347093-208347115 ACTTAGGGGAAGAGGGGAGCGGG - Intronic
947044004 2:225957420-225957442 ACTTGGGAGACCAAGGCAGGAGG - Intergenic
947181495 2:227415305-227415327 ACTTAGGAGACTAAGGCAGGAGG + Intergenic
1168950052 20:1791507-1791529 ACTTAGGAGGCTAGGGCAGGAGG + Intergenic
1169903573 20:10577470-10577492 ACTTTGGAGACCAAGGCAGAAGG + Intronic
1170072985 20:12389163-12389185 ACTTGGGTGAACAGAGCAGGTGG - Intergenic
1172662291 20:36575491-36575513 TTCTAGGTGGCCAGGGCAGCTGG - Intronic
1173403902 20:42748533-42748555 TCTAAGGTGACCAAGGCTGCTGG - Intronic
1175879466 20:62248797-62248819 ACTTAGGAGACTAAGGCAGAAGG - Intronic
1177264890 21:18769864-18769886 ACTTAGGTGTCCTAGGGAGCTGG - Intergenic
1177310062 21:19378985-19379007 CCTTAGCTGGCCAGGGCAGTTGG + Intergenic
1178520686 21:33286402-33286424 AATCAGGTGGCCAGGGCAGCTGG + Intronic
1179062235 21:37989668-37989690 ACTGAGGAGTCCAGGTCAGCAGG + Intronic
1179284344 21:39963916-39963938 ACTCAGGTGACCAGGGAGGCAGG - Intergenic
1179291326 21:40020701-40020723 AGGTAGGTGAGCAGGGCAGAAGG - Intronic
1179458021 21:41513007-41513029 AATTAGCTGAGCATGGCAGCAGG - Intronic
1180583241 22:16861041-16861063 ACTCAGGAGACCAAGGCAGGAGG + Intergenic
1180595066 22:16967698-16967720 AATTAGGTAACCAAGGCAGAGGG - Intronic
1180606462 22:17062572-17062594 ACTTGGGAGACCAAGGCAGGAGG - Intergenic
1180857329 22:19056808-19056830 AGCTCTGTGACCAGGGCAGCTGG - Intronic
1181630287 22:24147555-24147577 ACTTGGGAGGCTAGGGCAGCAGG - Intronic
1183027682 22:35078112-35078134 ACTGAGGTGTCAAGGACAGCAGG - Intronic
1183499049 22:38167502-38167524 GCACAGCTGACCAGGGCAGCGGG - Intronic
1183518221 22:38280348-38280370 ACTTAGGAGGCCAAGGCAGGAGG - Intergenic
1185237956 22:49725481-49725503 ACTGAGGTTTCCAGGGGAGCAGG - Intergenic
951321898 3:21255271-21255293 ACTTAGGTAAACAAAGCAGCGGG - Intergenic
951895180 3:27603249-27603271 ACTTGGGAGGCCAGGGCAGGAGG - Intergenic
952708014 3:36399617-36399639 TCTTAGGAGAGCAGGGCAGCTGG - Intronic
953359977 3:42287590-42287612 ACTTAGGTAAACAAAGCAGCCGG - Intergenic
953787204 3:45920322-45920344 ACTTAGGTCACAAGGGTAGCTGG + Exonic
954601392 3:51873266-51873288 ACTCAGGAGACTAAGGCAGCAGG + Intergenic
957238119 3:77621315-77621337 ACTTGGGAGACCAAGGCAGGAGG + Intronic
957942750 3:87025802-87025824 AGTTTCGTCACCAGGGCAGCTGG + Intergenic
959523384 3:107346234-107346256 ACTTCTGTGACCAGGGCATTGGG + Intergenic
960941362 3:122937162-122937184 ACTTTGCTGACAAGGGCGGCTGG - Intronic
961718068 3:128872492-128872514 ACTGAGGTGATTAGGGCAGTAGG + Intergenic
961764858 3:129201571-129201593 ACTTAGGAGGCCAAGGCAGGAGG + Intergenic
962221800 3:133570713-133570735 ACTCAGGAGGCCAAGGCAGCAGG + Intergenic
965051447 3:163654994-163655016 CCATAGGGGACCAAGGCAGCAGG + Intergenic
967157436 3:186706262-186706284 ACTCAGGTCTCCAGGGCAGAAGG + Intergenic
967158455 3:186714511-186714533 ACTCAGGTCTCCAGGGCAGAAGG + Intergenic
967864629 3:194180200-194180222 ACCAAGGTGGCCAGGTCAGCAGG - Intergenic
969379912 4:6788137-6788159 ACTCAGGAGGCCAAGGCAGCAGG - Intronic
969635144 4:8364863-8364885 ACTTGGGAGACAAGGACAGCTGG + Intergenic
971408862 4:26348810-26348832 ACTTGGGAGACTAGGGCAGAAGG - Intronic
971576374 4:28280382-28280404 ACATAGGTCACCAGGGAAGTGGG - Intergenic
974085050 4:57251342-57251364 ACTTGGGAGACCAAGGCAGGAGG + Intergenic
974821127 4:67068037-67068059 ACTTAGGTAAACAAAGCAGCCGG - Intergenic
975878593 4:78873934-78873956 CTTTGGGTGACCAGGGCAGGCGG + Intronic
975950316 4:79762451-79762473 GCTTAGGTGATGGGGGCAGCAGG + Intergenic
976845478 4:89484120-89484142 ACTCATGTCACCATGGCAGCAGG - Intergenic
976905179 4:90228072-90228094 GCTTAGGTAAACAGAGCAGCCGG + Intronic
977933013 4:102768729-102768751 ACTTTGGAGGCCAGGGCAGGTGG + Intergenic
977985312 4:103375851-103375873 AATTAGCTGGCCATGGCAGCAGG + Intergenic
978022864 4:103834759-103834781 ACTTGGGTGGCCAAGGCAGGTGG + Intergenic
978446030 4:108780909-108780931 ACTTGGGAGACCAAGGCAGGAGG - Intergenic
979336154 4:119465486-119465508 ACTTTGGGGACCAAGGCAGGAGG + Intergenic
981080458 4:140634734-140634756 ATTTTGGTGAGCAGGGAAGCAGG - Intronic
982029480 4:151285756-151285778 ACTTAGGAGACTGGGGCAGGAGG + Intronic
982782014 4:159501048-159501070 ATTTAGGAGCCCAGGGTAGCCGG - Intergenic
983716583 4:170788529-170788551 GCTTAGGTAAACAGAGCAGCCGG - Intergenic
984949545 4:184996737-184996759 ACTTAGGAGGCCAAGGCAGGAGG + Intergenic
985065389 4:186115936-186115958 ACTTAGGTAAACAAAGCAGCCGG - Intronic
985326634 4:188777904-188777926 ACTTAGCTGGCCATGGTAGCAGG + Intergenic
986220966 5:5768179-5768201 ACTGAGGTGGCCAGGGAGGCAGG + Intergenic
986348049 5:6852777-6852799 ACTTAGCTCACCTGGGGAGCTGG - Intergenic
986848829 5:11786163-11786185 ACTCAGGGGACCAGGCCAGCTGG + Intronic
987312347 5:16693020-16693042 ACTTGGGAGACCAAGGCAGGCGG + Intronic
988466622 5:31497928-31497950 ACTTAGATGACCAAGTCACCAGG + Intronic
991044622 5:62209967-62209989 ACTTTGGGGACCAAGGCAGGAGG - Intergenic
992235720 5:74706770-74706792 GCTTAGGTAAACAGAGCAGCCGG + Intronic
992386683 5:76291432-76291454 AGTCAGGTGTCCTGGGCAGCAGG - Intronic
993306482 5:86281364-86281386 ACTTAGGAGACCTGGGCTACAGG + Intergenic
993364605 5:87020206-87020228 ACTAAGGTGACTAAGGCAGCAGG + Intergenic
995928068 5:117399963-117399985 ATTTAGGAGACCAAGGCAGGTGG - Intergenic
996588379 5:125117663-125117685 TCATGGATGACCAGGGCAGCCGG + Intergenic
1000205022 5:159050545-159050567 ACTCAGGGGCCCAGGGGAGCTGG - Intronic
1000665195 5:163986276-163986298 ACTTTGGAGGCCAAGGCAGCCGG + Intergenic
1003413949 6:5891749-5891771 ACTTAGGTAAACAAAGCAGCCGG - Intergenic
1003813466 6:9811213-9811235 ACTTAGGTAAACAAAGCAGCCGG + Intronic
1003886593 6:10527085-10527107 ACTAATGTGATCAGGGAAGCAGG + Intronic
1003890872 6:10562606-10562628 ACTCAGGAGACCAAGGCAGAAGG + Intronic
1004845920 6:19641982-19642004 ACTTAGGTGATAAGGGGAGAAGG - Intergenic
1004996491 6:21198753-21198775 ACTTAGATGGCCAGGGAAGGAGG - Intronic
1005275836 6:24216424-24216446 ACTTAGGTGACCAGATCAAGGGG - Intronic
1006312248 6:33269008-33269030 ACTCACGTGACCAGAGCAGAAGG + Exonic
1007474979 6:42113516-42113538 ACTTAGAAAACCAAGGCAGCTGG + Intronic
1007840449 6:44711903-44711925 ACTAAGGTGAGAGGGGCAGCAGG + Intergenic
1008010051 6:46456928-46456950 AATGAGGAGCCCAGGGCAGCAGG - Exonic
1009618431 6:66040440-66040462 AATTAGCTGAGCATGGCAGCGGG + Intergenic
1010604561 6:77872334-77872356 ACTCAGGAGTCCAGGGCAGGAGG + Intronic
1012338382 6:98088719-98088741 ACTTAGGTAAACAAAGCAGCCGG - Intergenic
1012406980 6:98911152-98911174 ACTTAGGTAAACAAAGCAGCCGG + Intronic
1013074696 6:106761015-106761037 ACTTAGGAGGCCAAGGCAGGAGG + Intergenic
1013099346 6:106974426-106974448 GCTTAGCTGACCAGGGGAGAGGG - Intronic
1014885775 6:126779533-126779555 ACTTGGGTGGCCAGAGCAGAGGG + Intergenic
1015952948 6:138572357-138572379 AGTTACTTCACCAGGGCAGCTGG - Exonic
1018041977 6:159932797-159932819 ACTTAGCTGCCCAGGCCATCTGG - Intergenic
1018802722 6:167236206-167236228 ACTCAGGGGACCTGGCCAGCTGG - Intergenic
1018828494 6:167424320-167424342 GCGTAGGTGACCAGGGCAGGAGG - Intergenic
1019523852 7:1472075-1472097 ACTCAGGGGCCCAGGGGAGCTGG - Intronic
1020206787 7:6123982-6124004 ACTTAGGAGACCGAGGCAGGAGG - Intronic
1021232352 7:18101207-18101229 ACTAAGGAGATCAGAGCAGCTGG - Intronic
1022260941 7:28704290-28704312 ATTTAGCTGAGGAGGGCAGCAGG - Intronic
1022311007 7:29195375-29195397 ATTTGGGTGTCCAGGGTAGCGGG - Intronic
1022413899 7:30161574-30161596 ACTTGGGTGTCCTTGGCAGCGGG + Exonic
1022517125 7:30982941-30982963 ACTTGGGAGACCAAGGCAGGAGG - Intronic
1022675413 7:32495265-32495287 GCTTACGTGACCCGGGCGGCTGG - Intronic
1023006568 7:35876591-35876613 ACTTTGGGGACCAAGGCAGGAGG + Intronic
1023140630 7:37098566-37098588 ACTGAGGTGAGCTGGGCAGTGGG + Intronic
1023856300 7:44186163-44186185 GCAAAGGTGTCCAGGGCAGCTGG + Intronic
1023995353 7:45156224-45156246 AACAAGCTGACCAGGGCAGCAGG - Intergenic
1024067649 7:45754383-45754405 ACTTTGGGGACCAAGGCAGGAGG - Intergenic
1025213701 7:57036995-57037017 GCTTAGGTAAACAAGGCAGCAGG + Intergenic
1025658254 7:63539822-63539844 GCTTAGGTAAACAAGGCAGCAGG - Intergenic
1026186418 7:68085159-68085181 ACTTAGGAGGCCAAGGCAGGAGG - Intergenic
1026388305 7:69874147-69874169 ATTTGGGAGACCAGGGCAGGAGG + Intronic
1029217658 7:98962863-98962885 CCTTAGGTGATCAGGGCAGCTGG + Intronic
1029270152 7:99372784-99372806 TCTTAGGTCACAAGTGCAGCAGG + Intronic
1029570086 7:101363306-101363328 ACTTGGGGGCGCAGGGCAGCGGG + Intronic
1030541227 7:110832882-110832904 ATTTAGGTAACCAGGCCAGTAGG + Intronic
1032254771 7:130288318-130288340 ACTTTGGGGACCAAGGCAGGAGG - Intronic
1032309821 7:130774583-130774605 ACTTTGGAGACCAAGGCAGGAGG + Intergenic
1032813095 7:135442812-135442834 CCTTGGGTGGCCAAGGCAGCAGG + Intronic
1034120473 7:148622202-148622224 AATTAGCTGGCCATGGCAGCGGG + Intergenic
1034489819 7:151387243-151387265 TCCTGGGTGACCAGGGCAGGAGG + Intronic
1035356991 7:158281890-158281912 ACTTTGGTCACCAGAGGAGCAGG + Intronic
1035413670 7:158666681-158666703 ACTCAGGAGACCAAGGCAGGAGG + Intronic
1036982089 8:13481179-13481201 ACTTGGGAGGCCAAGGCAGCTGG + Intronic
1037238151 8:16745778-16745800 ACTTAGGAGGCTAGGGCAGGAGG - Intergenic
1037536202 8:19826985-19827007 TCTGAGGTGGGCAGGGCAGCAGG + Intronic
1038305350 8:26396073-26396095 GCTTAGGTAAACAGAGCAGCCGG + Intronic
1038382992 8:27114077-27114099 ACTTAGGTAAACAAAGCAGCCGG + Intergenic
1038450799 8:27637655-27637677 ACTGCGGTGGCCAGGGCAGGGGG + Intronic
1038839552 8:31169880-31169902 TCTTAGGTGAAGAGAGCAGCTGG - Intronic
1039300182 8:36200916-36200938 GCTTAGGTAAACAAGGCAGCCGG - Intergenic
1039439528 8:37585036-37585058 ACTTAGGAGACTGGGGCAGGAGG + Intergenic
1039632681 8:39130101-39130123 AATTAGGTGAGCATGGTAGCAGG - Intronic
1045014276 8:97985810-97985832 ACTTGGGAGACCAAGGCAGAAGG - Intronic
1046796933 8:118383690-118383712 AATTAGGTGACCTGGGCTGCTGG + Intronic
1047975394 8:130125027-130125049 GCTCAGATGACCAGGGCTGCTGG + Intronic
1049097251 8:140556324-140556346 ACTGGAGTGACCAGGGGAGCAGG + Intronic
1049680143 8:143914574-143914596 ACTTAGGGGAGGAGGGAAGCGGG - Intergenic
1050008394 9:1159140-1159162 ACTTGGGAGGCCAAGGCAGCAGG - Intergenic
1050218783 9:3361836-3361858 ACTCAGGAGACCAAGGCAGGAGG + Intronic
1051537670 9:18178476-18178498 GCTTAGGTGAACAAAGCAGCCGG + Intergenic
1051768089 9:20546432-20546454 ACTCAGGAGACCAAGGCAGGAGG + Intronic
1052923972 9:33998287-33998309 ACTCAGGAGACCGAGGCAGCAGG + Intronic
1053136299 9:35652257-35652279 ACTTTGGAGGCCAAGGCAGCAGG + Intergenic
1053183169 9:35991853-35991875 ACTTATGTGCCCATGGCTGCTGG - Intergenic
1057428094 9:94970245-94970267 AATTATCAGACCAGGGCAGCCGG + Intronic
1057714047 9:97474748-97474770 ACTTAGGTTACGAGTGCAGTAGG - Intronic
1059015329 9:110509617-110509639 ACTTAGGAGACTGAGGCAGCAGG - Intronic
1059148130 9:111920606-111920628 ACTTTGGAGGCCAGGGCAGGTGG - Intronic
1059930056 9:119251497-119251519 ACTCAGGTGGCCAAGGCAGGAGG + Intronic
1060684842 9:125599876-125599898 ACTTGGGAGGCCAAGGCAGCCGG - Intronic
1062084783 9:134642844-134642866 ACTTAGGTGACCAAGGCTGCAGG - Intronic
1062330973 9:136044842-136044864 ACCCAGGTGGCCAGGGCTGCTGG - Intronic
1203374183 Un_KI270442v1:349369-349391 GCTTAGGTGAACAAAGCAGCCGG - Intergenic
1185536620 X:867680-867702 ACGTAGGTGGTCAGGTCAGCCGG + Intergenic
1186042521 X:5496712-5496734 ACTTAGGTGATCAGAGAGGCAGG + Intergenic
1186877581 X:13831448-13831470 TCTTAAGTGACCAGTTCAGCAGG + Intronic
1189631054 X:42953610-42953632 ACTTAGGAGGCCAAGGCAGGTGG - Intergenic
1193118311 X:77797034-77797056 ACTTGGGAGACCAAGGCAGGTGG - Intergenic
1193775940 X:85641868-85641890 ACACAGGTCACCAGGGCAGTGGG + Intergenic
1194835303 X:98674137-98674159 AATTATGAGACCAAGGCAGCAGG + Intergenic
1195285100 X:103376435-103376457 ACTTGGGCGGCCAGTGCAGCAGG - Exonic
1195318916 X:103705366-103705388 TCTGAGCTGACCAGGGTAGCTGG - Intergenic
1195319035 X:103706469-103706491 TCTGAGCTGACCAGGGTAGCTGG - Intergenic
1197345006 X:125320130-125320152 ACTTTGGGGACCATGCCAGCGGG + Intergenic
1197605489 X:128580746-128580768 ACTTAGGAAGCCAAGGCAGCTGG + Intergenic
1200168803 X:154056802-154056824 AGCTGGGAGACCAGGGCAGCAGG + Intronic
1202601937 Y:26602233-26602255 ACTTAGGTAAACAAAGCAGCCGG + Intergenic