ID: 1142883200

View in Genome Browser
Species Human (GRCh38)
Location 17:2896787-2896809
Sequence CCTCATCTAATGCACCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 166}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142883187_1142883200 25 Left 1142883187 17:2896739-2896761 CCTGCCCTTTTTCCTAGCCCTGG 0: 1
1: 1
2: 2
3: 30
4: 302
Right 1142883200 17:2896787-2896809 CCTCATCTAATGCACCTGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 166
1142883194_1142883200 7 Left 1142883194 17:2896757-2896779 CCTGGTGCAGTTTAGGACTTCAG 0: 1
1: 0
2: 1
3: 12
4: 87
Right 1142883200 17:2896787-2896809 CCTCATCTAATGCACCTGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 166
1142883190_1142883200 20 Left 1142883190 17:2896744-2896766 CCTTTTTCCTAGCCCTGGTGCAG 0: 1
1: 0
2: 1
3: 15
4: 197
Right 1142883200 17:2896787-2896809 CCTCATCTAATGCACCTGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 166
1142883189_1142883200 21 Left 1142883189 17:2896743-2896765 CCCTTTTTCCTAGCCCTGGTGCA 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1142883200 17:2896787-2896809 CCTCATCTAATGCACCTGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 166
1142883193_1142883200 8 Left 1142883193 17:2896756-2896778 CCCTGGTGCAGTTTAGGACTTCA 0: 1
1: 0
2: 1
3: 13
4: 116
Right 1142883200 17:2896787-2896809 CCTCATCTAATGCACCTGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 166
1142883186_1142883200 28 Left 1142883186 17:2896736-2896758 CCTCCTGCCCTTTTTCCTAGCCC 0: 1
1: 0
2: 0
3: 36
4: 451
Right 1142883200 17:2896787-2896809 CCTCATCTAATGCACCTGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 166
1142883192_1142883200 13 Left 1142883192 17:2896751-2896773 CCTAGCCCTGGTGCAGTTTAGGA 0: 1
1: 0
2: 1
3: 11
4: 121
Right 1142883200 17:2896787-2896809 CCTCATCTAATGCACCTGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142883200 Original CRISPR CCTCATCTAATGCACCTGGA GGG Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
904369035 1:30036989-30037011 ACTCATCAGATGCACCTGGGAGG + Intergenic
906794087 1:48682868-48682890 CCTCATTTAATGGAGCTGGTGGG + Intronic
908760047 1:67503326-67503348 TCCCAGCTAATGCACCTGGTTGG - Intergenic
909941392 1:81615690-81615712 CCTCAAATAATGCTCCTTGAAGG - Intronic
911665246 1:100543938-100543960 CCTCACCTATTGCACCAGGCAGG - Intergenic
912032646 1:105268660-105268682 CTTTATCTAATCCACATGGATGG - Intergenic
913947845 1:143191749-143191771 CATCATCGAATGCACCCGAATGG + Intergenic
913948631 1:143201357-143201379 CGTCATCGAATGCACCCGAATGG + Intergenic
913952988 1:143256126-143256148 CATCATCGAATGGACCTGAATGG - Intergenic
913954019 1:143269234-143269256 CATCATCAAATGCAACTGAATGG + Intergenic
916948290 1:169752726-169752748 CCTAATATGATGCACCAGGAAGG + Intronic
919915339 1:202135478-202135500 TCTCATCCAATGCTCCCGGAAGG + Exonic
923236049 1:232034157-232034179 CCTCATTTAATGAGCCTGTAGGG - Intronic
1063176203 10:3552881-3552903 CCTGATCAAATGCACCAGGATGG - Intergenic
1066063628 10:31746087-31746109 CCTCACTTAATGCTCCTGGGAGG + Intergenic
1072437299 10:95425771-95425793 CCTCATCTTCTGAACTTGGAAGG + Intronic
1072954699 10:99878260-99878282 CATGATCTAATGCCCATGGAAGG + Intronic
1074935865 10:118180792-118180814 TCTCAACAAATGCATCTGGAAGG + Intergenic
1075741532 10:124699124-124699146 CCTCATTTAATGAACATGGCAGG + Intronic
1076668181 10:132104664-132104686 CATCTTCTCATTCACCTGGAGGG - Exonic
1078503327 11:11906706-11906728 GCTCATTTAATACACCTAGATGG - Intronic
1078625167 11:12948704-12948726 CCTCAGCCCATGCAGCTGGAGGG - Intergenic
1078843983 11:15105472-15105494 CCTCATCAGATACACCTGGAAGG + Intergenic
1081549799 11:44100651-44100673 CCGCATCTCCTGCAGCTGGAGGG + Intronic
1082655577 11:55852642-55852664 CCTCATCTAATTTAGCTGGCTGG + Intergenic
1084305945 11:68283365-68283387 CCTCTTCCAATGCTACTGGAAGG - Intergenic
1086269675 11:85046535-85046557 CCTAATGTAATCCACCAGGAGGG + Intronic
1087257687 11:95974952-95974974 CCTATTCTAATGAGCCTGGAAGG - Intergenic
1087530990 11:99381930-99381952 CTTCATCTGATGCTCCTCGAGGG + Intronic
1088367653 11:109056070-109056092 CTTAATCTCATTCACCTGGAAGG - Intergenic
1088645832 11:111915412-111915434 CCTCATGTAATACACCTTGGGGG + Intronic
1088649408 11:111944146-111944168 CCTCATCTTCTGCTGCTGGAGGG + Intronic
1089416425 11:118296010-118296032 CCTCATCTCCTGCAGCTAGAGGG + Intergenic
1089606238 11:119643178-119643200 CCTTGCCTGATGCACCTGGAGGG + Intronic
1090312968 11:125758666-125758688 CCTCAGCAAATGCACAAGGATGG + Intergenic
1093905791 12:24690642-24690664 CCTCTCCCATTGCACCTGGAGGG - Intergenic
1095865411 12:46966368-46966390 GCTCATCAAATCCACCTGCAGGG - Intergenic
1096333882 12:50738349-50738371 CCTGAGCCACTGCACCTGGATGG - Intronic
1096571824 12:52527763-52527785 CCACGTCTCATGCATCTGGAAGG - Intergenic
1097603683 12:61726356-61726378 ACTCATCTCATGCTCATGGATGG - Intronic
1099157305 12:79194368-79194390 CCACATCAGATTCACCTGGAGGG + Intronic
1100647908 12:96550860-96550882 CCTCATCTCTTGTCCCTGGATGG - Intronic
1101853703 12:108424790-108424812 CCTCATCTTCTGTAGCTGGAAGG - Intergenic
1104129056 12:125875015-125875037 CCTCATCAAATGCAGCTCAAAGG - Intergenic
1104869881 12:131987474-131987496 CTTCTTCTAAGGCTCCTGGAAGG + Intronic
1108229199 13:48319355-48319377 CCGCAGCTAGTACACCTGGATGG + Intronic
1112907504 13:104443001-104443023 CCTGGACTAATACACCTGGACGG - Intergenic
1116255873 14:42554572-42554594 CCACATATAATGCTCCTTGAGGG + Intergenic
1121656166 14:95597414-95597436 CCTATTTTAATGCACCTGAAGGG + Intergenic
1122305798 14:100765674-100765696 TCTCATCTCCTGCAGCTGGAGGG - Intergenic
1124492770 15:30168251-30168273 TCTCATCTAACCCACCTGGGAGG + Intergenic
1124750764 15:32370074-32370096 TCTCATCTAACCCACCTGGGAGG - Intergenic
1132469281 16:92956-92978 GCTCTTCTAATCCACCTTGAGGG - Intronic
1132754711 16:1477337-1477359 CCTGATGTGATGCACCAGGAAGG + Intergenic
1135701420 16:24635998-24636020 CCAAATCCAATGCACTTGGATGG - Intergenic
1136925054 16:34363958-34363980 CCTGATCCAATGCCCATGGAGGG + Intergenic
1136949777 16:34702391-34702413 CCTCATCTAATGGAATTGAAAGG - Intergenic
1136951764 16:34728676-34728698 CATCATCTAATGCAATTGAATGG - Intergenic
1136953315 16:34749195-34749217 AATCATCAAATGCACCTGAATGG - Intergenic
1136965822 16:34908868-34908890 CATCATCTAATGGAACTGAATGG - Intergenic
1136968922 16:34949619-34949641 CCTCATCGAATGGAACTGAATGG - Intergenic
1136979519 16:35047848-35047870 CCTGATCCAATGCCCATGGAGGG - Intergenic
1137089639 16:36172981-36173003 AATCATCTAATGCACCTGAATGG - Intergenic
1137094085 16:36231345-36231367 CCTCATCTAATGGAATTGAAAGG - Intergenic
1137094456 16:36236124-36236146 CCTCATCGAATGGAACTGAATGG - Intergenic
1137216822 16:46401987-46402009 AATCATCTAACGGACCTGGATGG + Intergenic
1137961822 16:52888760-52888782 GGTCATCTAATGGAACTGGATGG + Intergenic
1142819432 17:2453511-2453533 CCTGATGTGACGCACCTGGAAGG - Intronic
1142883200 17:2896787-2896809 CCTCATCTAATGCACCTGGAGGG + Intronic
1144290098 17:13818059-13818081 CCTCATCTGATTCACTTGGCAGG - Intergenic
1148672966 17:49426186-49426208 CCTGTTCTAAGGCCCCTGGATGG + Intronic
1203184653 17_KI270729v1_random:102915-102937 AATCATCTAATGGACCTGAAGGG - Intergenic
1155427989 18:25726013-25726035 CCTCATCTGCTGCACATAGAGGG + Intergenic
1155846021 18:30707866-30707888 TCTCATCAAATGCTCTTGGATGG - Intergenic
1156327064 18:36084320-36084342 ACACATCTAATGCTCATGGATGG + Intergenic
1156685899 18:39646009-39646031 CATCATGTAATACAACTGGAAGG - Intergenic
1160247232 18:77168758-77168780 CCTCATTTCGTGCTCCTGGAAGG + Intergenic
1161325685 19:3662796-3662818 CCTCAGCTAATCCACCTGCCTGG + Intronic
1163057684 19:14733477-14733499 CCTATTTTAGTGCACCTGGAGGG - Exonic
1164435850 19:28228621-28228643 CCTCATCTGGGGCACCTGGTGGG - Intergenic
1164630349 19:29757847-29757869 CCTGTTCTAATGGCCCTGGACGG + Intergenic
1165680580 19:37771172-37771194 CATCATCTGATCCACCTGCAGGG - Intronic
926054133 2:9764202-9764224 GCACAGCTCATGCACCTGGAAGG + Intergenic
930691158 2:54366345-54366367 CATCATCAAACACACCTGGATGG + Intronic
931024750 2:58098010-58098032 CCACATCTCATCCCCCTGGAAGG - Intronic
934191225 2:89797075-89797097 CATCATCGAATGCACTTGAATGG - Intergenic
934253568 2:90386319-90386341 AATCATCTAATGGACCTGAAAGG + Intergenic
934254081 2:90392668-90392690 AATCATCTAATGGACCTGAAAGG + Intergenic
934254244 2:90394653-90394675 GATCATCTAATGGACCTGAAAGG + Intergenic
934254614 2:90399331-90399353 AATCATCTAATGGACCTGAAAGG + Intergenic
934255021 2:91404374-91404396 ACTCATCTAATGCACTAGAATGG + Intergenic
934255644 2:91412744-91412766 AATCATCTAATGCACCCGAATGG + Intergenic
934256095 2:91418974-91418996 ACTCATCTAATGCACTAGAATGG - Intergenic
936117016 2:109710667-109710689 ACTCACCAGATGCACCTGGAAGG - Intergenic
936931612 2:117795767-117795789 CCTTATCTAAGGAACCTAGAGGG + Intergenic
937411277 2:121678625-121678647 CCTCAGGTAATGCACCTGCCTGG - Intergenic
938670045 2:133577908-133577930 CCTTTTCTAAGCCACCTGGAAGG - Intergenic
940688699 2:156886506-156886528 TGTCATCTATGGCACCTGGAGGG - Intergenic
941788436 2:169523849-169523871 ACACATCTAAGTCACCTGGAGGG - Intronic
942775971 2:179583080-179583102 CCTCAGGTGATCCACCTGGAAGG + Intronic
942840077 2:180349464-180349486 CCTCATCAAATTCACATGCAAGG + Intergenic
943212110 2:184980193-184980215 CCTCATCTCCTGCAGCTGCAGGG + Intergenic
943679855 2:190756835-190756857 CCTCATTTAATTCACCTGTCAGG - Intergenic
944096594 2:195975345-195975367 CCTCAGCAAATGCCCATGGAGGG + Intronic
944605938 2:201351368-201351390 TCTCATCTACTGCACCTGCTGGG - Exonic
944980834 2:205118157-205118179 CTTAATCTGATGGACCTGGAGGG - Intronic
946397523 2:219450773-219450795 CCCCATGCAAGGCACCTGGAGGG - Intronic
1172311075 20:33918859-33918881 CATCATCGCATGCACCTGGGCGG + Intergenic
1172318379 20:33974830-33974852 CCACATCTCATGCCACTGGAAGG - Intergenic
1173964851 20:47104786-47104808 CCTCATGTAATCCACCTGCCTGG - Intronic
1174011584 20:47454135-47454157 CCTCCTCTATTGCACCAGGGTGG - Intergenic
1174426512 20:50435483-50435505 CCTCATCTCATGCACCTGCCCGG - Intergenic
1175126989 20:56759830-56759852 CCTGATCTAATGCACCGACAGGG - Intergenic
1178636550 21:34308703-34308725 CCTCATCTCGTGCACCTACACGG + Intergenic
1179028046 21:37696366-37696388 CCTGATATAATGCACTGGGAGGG + Intronic
1179223334 21:39429491-39429513 CCTCATCTCAGCCACCTAGAGGG + Intronic
1180087226 21:45513194-45513216 CCCCATCTCATGCCCCTGGCTGG + Exonic
1181872526 22:25911257-25911279 CCTCATCCATTGCTCCTGGCTGG - Intronic
1184483151 22:44759844-44759866 CCTCACCTCTTGCAGCTGGAGGG + Intronic
1184692434 22:46123397-46123419 CCTCATCTAGAGCACAAGGATGG - Intergenic
1203321092 22_KI270737v1_random:62003-62025 CCTCATCTAATGGAATTGAATGG + Intergenic
952339498 3:32433509-32433531 ACTCATCAAATGCCCCCGGAGGG - Intronic
954213001 3:49108844-49108866 CCTCAGCTTATGCATCTGGTGGG - Exonic
955581446 3:60427408-60427430 CCTCAGCTAAAGGTCCTGGAAGG - Intronic
958720553 3:97837927-97837949 CCTCCTGTAATGCACCTGTTGGG - Intronic
960997116 3:123347615-123347637 ACTCATTTAACACACCTGGAGGG + Intronic
963852660 3:150223941-150223963 CTTCATCTCCTGCAGCTGGAAGG + Intergenic
967302167 3:188025290-188025312 CCACATCTAATGCTCTTGGGTGG - Intergenic
967525485 3:190487796-190487818 CCTCATCTAAGGCAACTCTACGG + Intergenic
967947267 3:194813961-194813983 TTTCATCTCCTGCACCTGGAGGG + Intergenic
970070092 4:12148396-12148418 CCTCACCTCATCCTCCTGGAAGG + Intergenic
971402923 4:26293271-26293293 CCCCATCTCTTGCATCTGGAAGG + Intronic
978836897 4:113161819-113161841 CCTCTTGTAATGCCCCTGGAAGG - Intronic
980283149 4:130747470-130747492 TCTCATATAAAGCATCTGGATGG + Intergenic
980644753 4:135629008-135629030 ACACATCTAATGCTCATGGATGG - Intergenic
981644746 4:146986121-146986143 CCTCATGGAATACTCCTGGAAGG - Intergenic
984937119 4:184899080-184899102 TCTCATCTCAAGCACCTGGAAGG + Intergenic
988805157 5:34733603-34733625 CCTTCTCTAAAGCACCTGAAGGG + Intronic
991256689 5:64622052-64622074 CCTCATCTTCTGTAGCTGGAGGG - Intergenic
993184713 5:84602311-84602333 CCTCAACTAATGAAGTTGGACGG + Intergenic
997597350 5:135116019-135116041 CCTCTTATAAAGCAGCTGGAAGG - Intronic
997617061 5:135254248-135254270 CATCAGCTAATGCATCTGAATGG - Intronic
999274359 5:150319163-150319185 CCTCCTGGAATGCAGCTGGAGGG - Intronic
999535026 5:152506648-152506670 CCTCATCTCCTGCAGCTAGAGGG - Intergenic
999620463 5:153467628-153467650 CCTTATCAAATGCTCCTGGTAGG - Intergenic
999720506 5:154395937-154395959 CCTCATCGGAAGCACCTGCAGGG - Intronic
1002319214 5:178365202-178365224 CCATATCTAATGTTCCTGGATGG - Intronic
1003548173 6:7078658-7078680 ACACATCTAATGCACTTTGAAGG - Intergenic
1006435560 6:34024233-34024255 CCTCATGAAATACACATGGAAGG + Intronic
1007785918 6:44279252-44279274 ACTCATGTAGGGCACCTGGAAGG + Exonic
1008329815 6:50231532-50231554 CTTCTTAAAATGCACCTGGAGGG + Intergenic
1010378900 6:75205119-75205141 CCTCCACCAATGCACCGGGAGGG + Intronic
1011501749 6:87998001-87998023 GCACATCTCATGCACCTAGAAGG - Intergenic
1014787876 6:125638803-125638825 CCTAATCTCTTGCAGCTGGAGGG - Intergenic
1017457673 6:154616631-154616653 CCTCTCTGAATGCACCTGGAGGG + Intergenic
1017908227 6:158771285-158771307 CTTCATCTGCTGCACCTCGATGG + Exonic
1019261754 7:85908-85930 CTTCATCATATGCTCCTGGAAGG + Intergenic
1019318073 7:400626-400648 CCTCCCCTAATACACCTGGGTGG - Intergenic
1019536680 7:1533124-1533146 CCTCATCTACAGCAGCTGGTCGG - Intronic
1019613404 7:1948116-1948138 CCTCATCTGGGGCACCTGCAGGG + Intronic
1025476565 7:60929545-60929567 AATCATCTAATGCAACTGAATGG - Intergenic
1025484464 7:61029460-61029482 AATCATCTAATGTACCTGAATGG - Intergenic
1025487500 7:61069334-61069356 AATCATCTAATGGACCTGAATGG + Intergenic
1025558467 7:62339514-62339536 AATCATCTAATGTACCTGAATGG + Intergenic
1025566731 7:62444509-62444531 AATCATCTAATGGACCTGAAGGG - Intergenic
1027942644 7:84704553-84704575 TCTCCTCTAATGCCTCTGGAGGG - Intergenic
1036236647 8:7044725-7044747 TCTCCTCTGATGCCCCTGGAGGG + Intergenic
1048838233 8:138541634-138541656 CCTGCTCTAATACTCCTGGAAGG + Intergenic
1055401525 9:75929559-75929581 CCTCCCCTACTGCAGCTGGAGGG - Intronic
1055591556 9:77820361-77820383 CTGCATATAATGCACCTGAAAGG - Intronic
1196846924 X:119903863-119903885 CCCCATTTAATGCACCAGCATGG - Intronic
1197060089 X:122168356-122168378 ACTCATCTCATGCTCATGGATGG + Intergenic
1200791688 Y:7304985-7305007 CCTCATCTAAGGCACCTGGGTGG - Intergenic