ID: 1142884785

View in Genome Browser
Species Human (GRCh38)
Location 17:2905769-2905791
Sequence TTCTGAGCTGGGCCTGTTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 245}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142884780_1142884785 -9 Left 1142884780 17:2905755-2905777 CCTCTGGCTGGCCCTTCTGAGCT 0: 1
1: 0
2: 5
3: 21
4: 260
Right 1142884785 17:2905769-2905791 TTCTGAGCTGGGCCTGTTCACGG 0: 1
1: 0
2: 0
3: 24
4: 245
1142884779_1142884785 -5 Left 1142884779 17:2905751-2905773 CCGGCCTCTGGCTGGCCCTTCTG 0: 1
1: 0
2: 7
3: 52
4: 450
Right 1142884785 17:2905769-2905791 TTCTGAGCTGGGCCTGTTCACGG 0: 1
1: 0
2: 0
3: 24
4: 245
1142884774_1142884785 29 Left 1142884774 17:2905717-2905739 CCTGGGACTTGAAGGGCATTTGC 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1142884785 17:2905769-2905791 TTCTGAGCTGGGCCTGTTCACGG 0: 1
1: 0
2: 0
3: 24
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142884785 Original CRISPR TTCTGAGCTGGGCCTGTTCA CGG Intronic
900031753 1:377800-377822 CTCTGAGCTGGGCCTGTCTCCGG + Intergenic
900052300 1:605991-606013 CTCTGAGCTGGGCCTGTCTCCGG + Intergenic
900545677 1:3227801-3227823 TCCTGAGCAGGACCTGTTCCTGG + Intronic
900662752 1:3793667-3793689 TTCTGAGCTGTGTCTTTTCAGGG + Intronic
900720067 1:4170173-4170195 AGCTGAGCTGGGCCAGGTCAGGG + Intergenic
901689212 1:10961482-10961504 TTCTGAGCTGGGCTGGTGCAGGG + Intronic
902727560 1:18347227-18347249 GAATGAGCTGGGCCTGTTCCTGG - Intronic
906299282 1:44670427-44670449 TTCTGAGATCTGCATGTTCAAGG + Intronic
907913290 1:58846038-58846060 TTCTGAGCAGGGCATTTTCGAGG + Intergenic
908960403 1:69690797-69690819 TTCTGGGCTGGGCTTTTTAAGGG + Intronic
910403022 1:86855881-86855903 CTCTGGGCTGTGCCTGTGCAGGG + Intergenic
911850380 1:102811172-102811194 TTCTGGGCTGGGGCTTTTAAGGG + Intergenic
913966129 1:143379091-143379113 TGCTGAGATGGGCTTGTGCAAGG + Intergenic
914060503 1:144204698-144204720 TGCTGAGATGGGCTTGTGCAAGG + Intergenic
914118647 1:144761671-144761693 TGCTGAGATGGGCTTGTGCAAGG - Intergenic
915733209 1:158068585-158068607 TGCTGAGCTGGGGCTGGGCAGGG - Intronic
916403211 1:164470884-164470906 ATCTGAGCAGGGCATTTTCAAGG + Intergenic
919247401 1:195005779-195005801 CTCTGAGCCAGGCCTGTGCATGG - Intergenic
920729460 1:208469367-208469389 ATCTGAGCAGAGCCTGTTCCTGG - Intergenic
921005554 1:211089884-211089906 TGATGAGCTGGACCTCTTCAGGG + Intronic
921614861 1:217254196-217254218 TACTAAGCTTGACCTGTTCATGG - Intergenic
921949564 1:220915366-220915388 TTTTGAGCTAGGCATGTGCAGGG + Intergenic
923911316 1:238447220-238447242 TTTTGAGCTGTACTTGTTCAAGG - Intergenic
1064478570 10:15718480-15718502 TTCTGAGATGAGCATTTTCAGGG - Intronic
1065444802 10:25787260-25787282 TTCAGAGCAGGGCGAGTTCATGG + Intergenic
1067054807 10:43044330-43044352 GTCTCAGCTGGGCCTGGCCATGG + Intergenic
1067662470 10:48246726-48246748 TTCTGAGCACAGCCTGTCCAGGG + Intronic
1069985567 10:72280639-72280661 TTCTCAGCTGGGCCCCTGCATGG - Intergenic
1070892125 10:79948833-79948855 TTCTGAGCTGGGGGTGCACAGGG - Intronic
1071166825 10:82816732-82816754 TTCTGAGTTGGGGCTGCTGAGGG - Intronic
1071983004 10:91022675-91022697 TGCTGGGATGGGCATGTTCAAGG + Intergenic
1072408047 10:95173124-95173146 TGGTGAGCTGGCCCTGGTCATGG + Intergenic
1072610632 10:97015138-97015160 TTCTGAGCTGGGTCAATTTAGGG - Intronic
1073073826 10:100810873-100810895 GGCTGAGCTGGGACTGTTCCAGG - Intronic
1073485336 10:103814212-103814234 TTCTGAGCTGTGGCTGTGCTGGG + Intronic
1074470481 10:113722148-113722170 TTCTGAGATGGGCCTGGCCATGG - Intronic
1075729824 10:124629482-124629504 TTGTGAGTTGGGCTTGTTGATGG - Intronic
1075844464 10:125534304-125534326 TTCTGAGCCGGTGCTCTTCATGG - Intergenic
1076705323 10:132298227-132298249 ATCTGAGCTGGGCCTGTGACTGG + Intronic
1077584635 11:3441327-3441349 CTCTGAGCTAGGCCCGTTCTAGG - Intergenic
1077678544 11:4219141-4219163 TCCTAAGCTGTGCATGTTCAGGG - Intergenic
1077682085 11:4251191-4251213 TCCTTAGCTGTGCATGTTCAGGG + Intergenic
1077687947 11:4315544-4315566 TCCTAAGCTGTGCATGTTCAGGG - Intergenic
1077712528 11:4551424-4551446 TTCTGAGCTGCACCTTTTGATGG - Intergenic
1078147746 11:8733437-8733459 CTCTGTGCTAGGCCTGTTCTAGG + Intronic
1078433278 11:11303758-11303780 TTCTGACCTGGGACTGTTTATGG + Intronic
1078502601 11:11896424-11896446 TTCTGAGCTGAGGCTGCTCTGGG - Intronic
1079298847 11:19259277-19259299 TTGTGAGCTGGGGCTGTAAATGG + Intergenic
1081883901 11:46478277-46478299 TTCTGAGTTGCTTCTGTTCAAGG + Intronic
1083745377 11:64733299-64733321 TGGTGAGCTGGGCCTGGTCCTGG + Intronic
1084241540 11:67823981-67824003 CTCTGAGCTAGGCCCGTTCTAGG - Intergenic
1084830901 11:71768655-71768677 CTCTGAGCTAGGCCTGTTCTAGG + Intergenic
1086425980 11:86682673-86682695 TCCTAAGCTGGGCCCCTTCAAGG + Intergenic
1086523311 11:87697054-87697076 TTCTGGGCTGGCCCTGTGGATGG + Intergenic
1086816564 11:91379600-91379622 TTCTGAGCTGGCCCTGTGGGAGG - Intergenic
1086836565 11:91631556-91631578 TTCTGACGTGGGCCTGATCTTGG - Intergenic
1087151942 11:94867358-94867380 TGCTGAGCCAGGCCTGGTCAAGG + Intronic
1088906790 11:114161163-114161185 TTCTGAGATGGGCCAGTGTAAGG + Intronic
1091214490 11:133892335-133892357 TTCTCAGCTGGGACTGTGGATGG + Intergenic
1092272272 12:7032659-7032681 TTCTGAGCTGGGGTTTTTAAGGG + Intronic
1092501724 12:9053980-9054002 TTCTGGGCTGGGGCTTTTAAGGG - Intergenic
1092855695 12:12671675-12671697 TTCTGAGCCAGGAATGTTCATGG - Intronic
1095354471 12:41255353-41255375 ATCTAAACTGGGGCTGTTCATGG + Intronic
1095516263 12:43009215-43009237 TTTTTAGCTCTGCCTGTTCAAGG - Intergenic
1098928081 12:76375686-76375708 TTCTGAGCTGAGGCTGAGCAAGG + Intronic
1102586614 12:113927484-113927506 GTGTGAGCTGGTCCTGTTTAAGG - Intronic
1103342121 12:120226228-120226250 TTCTTAGCTGGCCCTGCCCATGG - Intronic
1104218918 12:126763009-126763031 TTCTGGGCTGGAGCTGTTCATGG - Intergenic
1104667536 12:130657912-130657934 TTCTCAGCCAGGCCTGTTTAAGG - Intronic
1105844372 13:24281693-24281715 CACTGAGCTGGGTCTGCTCATGG - Intronic
1106169368 13:27275704-27275726 TCCTGTGCTGGGCCAGTTCCAGG - Intergenic
1108568757 13:51728879-51728901 TTCTGAGGTGGGACAGTTCTGGG - Intronic
1109265672 13:60197370-60197392 TTCTGAGATATGCCTGTACATGG - Intergenic
1110624530 13:77637851-77637873 TGGTGAGCTGGCCCTGTTCCAGG + Intronic
1113544507 13:111137735-111137757 TCCTGAGCTTGGCCTCTTAATGG - Intronic
1114293623 14:21309197-21309219 TTCTGATCTGGCACTGTTAAAGG - Intronic
1117089839 14:52238493-52238515 TCCTGAGCTGTGCCAATTCATGG - Intergenic
1118163459 14:63313668-63313690 CCCTGAGCTGGGGCTGTTCCTGG - Intronic
1122517494 14:102319181-102319203 TTCTGGGCAGGGCCTGTGCTGGG + Intronic
1122891587 14:104734545-104734567 TTCTGAGCCAGCCCTGTTCTGGG - Intronic
1202923999 14_KI270724v1_random:7658-7680 TTCTGGGCTGGGGCTGTTGGGGG + Intergenic
1125747090 15:42004586-42004608 TTCTCAGCTGGGCCTCAACAAGG + Intronic
1127292599 15:57583552-57583574 TTCTGGGCTGGGGCTTTTAAGGG + Intergenic
1128207148 15:65862936-65862958 TTCTGGGCTGGGTGTGGTCAAGG + Intronic
1131703680 15:94969628-94969650 TTCTAGGCTGGGCCTGAGCATGG - Intergenic
1132345927 15:101108839-101108861 TGCTGAGCTGGACCTGTTAGGGG - Intergenic
1133353039 16:5114926-5114948 CTCTGAGCTAGGCCCGTTCTAGG - Intergenic
1134407231 16:13971257-13971279 TTCTGAGCTGTATCTGTTTATGG + Intergenic
1134492874 16:14708985-14709007 TGGTGAGCTGGCCCTGGTCATGG - Intronic
1134498255 16:14748107-14748129 TGGTGAGCTGGCCCTGGTCATGG - Intronic
1134582319 16:15380984-15381006 TGGTGAGCTGGCCCTGGTCATGG + Intronic
1135313640 16:21425035-21425057 TGGTGAGCTGGCCCTGGTCATGG + Intronic
1135366564 16:21857315-21857337 TGGTGAGCTGGCCCTGGTCATGG + Exonic
1135445251 16:22513843-22513865 TGGTGAGCTGGCCCTGGTCATGG - Exonic
1135666871 16:24343289-24343311 TTGTGAAATGGGCCTATTCATGG - Intronic
1136193968 16:28638402-28638424 TGGTGAGCTGGCCCTGGTCATGG - Exonic
1136310302 16:29403739-29403761 TGGTGAGCTGGCCCTGGTCATGG + Exonic
1136323751 16:29505529-29505551 TGGTGAGCTGGCCCTGGTCATGG + Exonic
1136438436 16:30245510-30245532 TGGTGAGCTGGCCCTGGTCATGG + Exonic
1137712526 16:50576193-50576215 ATCTGACCAGGGCCTGTTCAGGG - Intronic
1141652388 16:85400009-85400031 GTTTGCGCTGGGCCTGCTCAGGG - Intergenic
1141712747 16:85709550-85709572 TACTGAGCTGGGCCTATGCCGGG - Intronic
1142201425 16:88762809-88762831 TTCTCAGCTAGGCCTGGTCAGGG - Intronic
1142884785 17:2905769-2905791 TTCTGAGCTGGGCCTGTTCACGG + Intronic
1143267542 17:5651440-5651462 TTCTGGGCTGGGGCTTTTAAGGG - Intergenic
1143324750 17:6091513-6091535 CTTTGAGCTGGGCCCCTTCAGGG - Intronic
1143335524 17:6169164-6169186 TTCTCAGCTGGGACAGTTTAGGG - Intergenic
1143953672 17:10652993-10653015 CTGTGAGCTGGGCTTGTTCTAGG - Intronic
1144190450 17:12840906-12840928 TCCTGAGCTGGGTCAGGTCAGGG - Intronic
1148972308 17:51494490-51494512 TTCTGGGCTGGGGCTTTTAAGGG + Intergenic
1149290575 17:55214380-55214402 TTCTGAGCAGGGCCTTTGCCAGG + Intergenic
1149437326 17:56644365-56644387 TTCTGAGCTGGACCGGTCCTGGG - Intergenic
1150656361 17:67042283-67042305 CTCTGGGCTGGGCCCTTTCAGGG + Intergenic
1151021753 17:70624995-70625017 TTCAGTGATGGGCCTGTGCATGG - Intergenic
1151520653 17:74627007-74627029 TTCTGGGCTGGGACTTTTAAGGG + Intergenic
1151652465 17:75478515-75478537 TCCAGAGCTGGGCCTGCTCAGGG + Intronic
1152762158 17:82114491-82114513 TTTTGAGCTGAGACTGTTCTGGG - Intronic
1152947903 17:83207914-83207936 CTCTGAGCTGGGCCTGTCTCCGG - Intergenic
1154119434 18:11639398-11639420 TGGTGAGCTGGCCCTGGTCATGG + Intergenic
1155201064 18:23518111-23518133 CTCTGTGCTGGGCCTGCCCAGGG - Intronic
1156402602 18:36753296-36753318 CTCTGAGGTGGGCTTTTTCAGGG + Intronic
1156463513 18:37334660-37334682 TTCTAAGCTGAGCCTCTCCACGG + Intronic
1157324928 18:46662140-46662162 TTCTGAGCTGGGGCTTTTAAGGG - Intergenic
1157426110 18:47585476-47585498 ATCTGAGCTGGGCTTGTTGTAGG + Intergenic
1158415390 18:57245917-57245939 TTCTGAGCCCAGCCTCTTCAGGG - Intergenic
1161123907 19:2545272-2545294 CTCTGAGGTGGGCCTGTCCTGGG - Intronic
1161587955 19:5115530-5115552 GTGTGAGCTGGGCCTGGTGAAGG - Intronic
1162476587 19:10904131-10904153 TCCTGACATTGGCCTGTTCAAGG + Intronic
1162931665 19:13960695-13960717 TGCTGAGCTGGGCCTGGCCTGGG - Intronic
1163134456 19:15299528-15299550 TTCTTAGCTGGGCTTGGCCATGG - Intronic
1165369198 19:35392152-35392174 TTCAGAGCTTGGCCTGCTCAAGG - Intergenic
1166432665 19:42740478-42740500 TTCTGCGCTGAGCCTCTTCCCGG + Exonic
1166445646 19:42855713-42855735 TTCTGCGCTGAGCCTCTTCCTGG + Intronic
1166492218 19:43269525-43269547 TTCTGTGCTGAGCCTCTTCCCGG + Exonic
1166611156 19:44198710-44198732 TTCTAAGGTAGACCTGTTCAGGG + Intergenic
1168332692 19:55579291-55579313 GCCTGAGCTGGGCCGGTTCTGGG + Exonic
1202699910 1_KI270712v1_random:156586-156608 TGCTGAGATGGGCTTGTGCAAGG + Intergenic
925232310 2:2244651-2244673 CTCTGAGCTGGCTCTGTTCCTGG - Intronic
925705337 2:6679498-6679520 TTCTGATCTGGGCCTCTCAACGG + Intergenic
925765181 2:7226680-7226702 TTCAGATCTGTGCCTTTTCATGG - Intergenic
926381614 2:12296232-12296254 TTGTGAGCTGGGAGTGATCAAGG + Intergenic
928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG + Intronic
931779313 2:65565832-65565854 TTCTGGGCTGGGCCTGCGCCAGG + Intergenic
934170845 2:89540061-89540083 TGCTGAGATGGGCTTGTGCAAGG + Intergenic
934281150 2:91614379-91614401 TGCTGAGATGGGCTTGTGCAAGG + Intergenic
935148634 2:100413934-100413956 CTCTGAGCCGGGGCTGTTCTAGG + Intronic
935764311 2:106350145-106350167 TTCTGAGTTGTGCCTTTGCAGGG + Intergenic
937493289 2:122392375-122392397 TTCTGAGCTGGGGCTTTGAAGGG + Intergenic
938088054 2:128414450-128414472 ATCTCAGCTGGGCCTGCTCATGG + Intergenic
938381851 2:130840782-130840804 TTCTGAGCTGACACTGTTCCTGG - Intronic
938941515 2:136173528-136173550 TCCAGAGCTGGGCTTCTTCATGG + Intergenic
939760516 2:146171589-146171611 TTCTAAGCTGGGGCTTTTAAGGG + Intergenic
942398474 2:175576724-175576746 TTCTGAACTCGGCCTGCTCCTGG - Intergenic
942939115 2:181596469-181596491 TTATGAGCTAGGGCTGTTGATGG + Intronic
946167725 2:217875686-217875708 TTATGAGCTGGGCTTATCCAAGG - Intronic
946176026 2:217922428-217922450 TTCTGAGCTTGGGCTGGGCAGGG + Intronic
947315500 2:228853605-228853627 CTCTTAGCTGGGCCTGTCAATGG + Intronic
949015709 2:241708982-241709004 TTCAGAGCTGGGACTGTCCTGGG + Intronic
1168923090 20:1557445-1557467 TTCTGAGTTCTGCCTGTTCTGGG + Intronic
1172323669 20:34017677-34017699 TTCTGAACTGGCCTTGTGCAAGG + Intronic
1172677651 20:36685680-36685702 TTCTGATCTGGGTCTGTTCCTGG - Intronic
1173137813 20:40455669-40455691 TTCTGTGCTGGGCTTGCTGATGG + Intergenic
1173522968 20:43712667-43712689 TTCTCTGCTGGGCCTGTTTGAGG + Intronic
1174199284 20:48795763-48795785 TTCTGAGCTGGCTTTGCTCATGG - Intronic
1174498632 20:50967689-50967711 TTCTGAGCTCGGCTCATTCAAGG - Intergenic
1175072015 20:56342933-56342955 ATCTCAGCTGGGCTTGTCCATGG + Intergenic
1175604256 20:60299386-60299408 TGCGGGGCTGGGCCTGTTCAGGG - Intergenic
1178204142 21:30443579-30443601 TTCTGGGCTGAGCTGGTTCAAGG - Intergenic
1178270296 21:31183314-31183336 TTCTAGGTTGGGCTTGTTCATGG - Intronic
1180107875 21:45631697-45631719 TTCTGACCTGGCCCTGCTCTTGG - Intergenic
1181429328 22:22868398-22868420 TTGTGATCTGTGACTGTTCACGG - Intronic
1182002853 22:26935367-26935389 CTCTGAGCTGGCTCTGTTCTTGG + Intergenic
1182700780 22:32236098-32236120 TTCTGTGCTGTTCTTGTTCATGG - Intronic
949991584 3:9583613-9583635 TTCTGGGCTGGGGCTTTTAAGGG + Intergenic
952594930 3:35005777-35005799 TTCTGAGTTGGGACTTTTAAGGG + Intergenic
953351750 3:42221365-42221387 GTGTGAGATGGGCCTGTTCTGGG + Intronic
953491324 3:43354452-43354474 TCCTGTGTTTGGCCTGTTCAAGG - Intronic
954472204 3:50707674-50707696 GTCTGAGCTGGGTCAGTTCTTGG + Intronic
957057012 3:75450889-75450911 CTCTGAGCTAGGCCCGTTCTAGG - Intergenic
961296459 3:125888827-125888849 CTCTGAGCTAGGCCCGTTCTAGG + Intergenic
961889335 3:130117289-130117311 CTCTGAGCTAGGCCCGTTCTAGG - Intergenic
962932244 3:140049166-140049188 TCCAGAGCTGGCCCTCTTCAGGG - Intronic
968735881 4:2296361-2296383 CTCTCACCTGGGCCTGTGCACGG + Intronic
968999824 4:3971178-3971200 CTCTGAGCTAGGCCCGTTCTAGG - Intergenic
969155224 4:5204277-5204299 TTCTGTGCTGGGACTGTGCTGGG + Intronic
969411645 4:7032222-7032244 GTCTGAGCTGGGCCTGTGGGAGG + Exonic
969814077 4:9673733-9673755 CTCTGAGCTAGGCCTGTTCTAGG + Intergenic
970395636 4:15662556-15662578 TTCTAAGCTTGACCTTTTCAAGG - Intronic
971368489 4:25996028-25996050 CTCTGAGCTAGGCCTGGCCAAGG - Intergenic
973650625 4:52994027-52994049 TTTGGAGCTGCTCCTGTTCAGGG + Intronic
974210037 4:58760262-58760284 ATCTGAGCTGGGTGTGTTAATGG + Intergenic
975664024 4:76716219-76716241 CGCTGAGCTGGGCAAGTTCAAGG + Intronic
975841667 4:78480794-78480816 TCCTGATCTGGGCCAGATCAAGG + Intronic
977520989 4:98083174-98083196 TTCTGAGATGGGACTGATTAAGG - Intronic
983249175 4:165325868-165325890 TTCTGTGCTGGGGCTTTTAAGGG + Intergenic
983870789 4:172822938-172822960 TCCTTAGCTGGGCATTTTCATGG + Intronic
985563633 5:604380-604402 TTCGGAGATGGGCTTGCTCACGG + Intergenic
986518103 5:8584171-8584193 TTCTCAGCTTGGCCTGTCCATGG + Intergenic
987059453 5:14228065-14228087 CAGGGAGCTGGGCCTGTTCAGGG + Intronic
989117464 5:37969267-37969289 TGCTTGGCTGGGGCTGTTCACGG + Intergenic
992549968 5:77850912-77850934 TACTGAGCTGGGGCTGGGCAAGG - Intronic
995065448 5:107857023-107857045 TTCTCAGCCTGGGCTGTTCATGG - Intergenic
996536451 5:124582782-124582804 GTTTGATCTGGGCCTGTTCCAGG - Intergenic
998295954 5:140968647-140968669 TTCTGACCTGGACCTCTTTAAGG + Exonic
999139359 5:149347463-149347485 TCCTGACCTGGCCCAGTTCAAGG - Intronic
1000518323 5:162268282-162268304 TTTTGAGTTGGGCTTGTTGACGG - Intergenic
1001490132 5:172149229-172149251 TTCTGTGCTAGGCCTGTGCCGGG - Intronic
1001524522 5:172419139-172419161 ATCTCAGCTTTGCCTGTTCAGGG - Intronic
1001828712 5:174767460-174767482 TTTGGAGCTGGGCCTTTTAAAGG + Intergenic
1002542804 5:179917321-179917343 CTGTGAGCTGGGCCTGTGCCCGG - Intronic
1002742067 5:181441068-181441090 CTCTGAGCTGGGCCTGTCTCCGG - Intergenic
1002856834 6:1045378-1045400 TTCTGACCTGGACATGGTCAAGG + Intergenic
1003291962 6:4787643-4787665 GTCTGAGCTGGGCAGCTTCATGG + Intronic
1004305026 6:14492816-14492838 TTCTGGGCTGGGGCTTTTAAGGG - Intergenic
1005147372 6:22706946-22706968 GTCTGAGCTGGGGTTTTTCATGG - Intergenic
1005890893 6:30136942-30136964 TTCTTATCTGGGACTGTTGAGGG + Exonic
1005906193 6:30262961-30262983 TGCTGTGCTGGGCCTGTTGTAGG + Intergenic
1006055946 6:31384671-31384693 TTCTGAGTTGTGCCTGTTGAAGG + Intergenic
1007412582 6:41673585-41673607 CTCTGAGCTGGGCCTGTCCTGGG - Intergenic
1007843840 6:44738249-44738271 ATCTGACCTGGGCCTGTCCCCGG + Intergenic
1010790480 6:80058494-80058516 TTCTGAACTGGGACTTTTCTGGG - Intergenic
1013141202 6:107336881-107336903 TTCGGGGCTGGGCCTGGTCAGGG + Intronic
1013510649 6:110841421-110841443 GTCTGTGCTGGGCTTGCTCACGG + Intronic
1013603941 6:111730949-111730971 TTCTGGGCTGCGCCTGTTTAAGG + Intronic
1016586911 6:145698453-145698475 TTCTTAGCTGGAACTGATCAAGG - Intronic
1016956066 6:149627853-149627875 TTGTGGGCTGGGCTTGTTCAAGG + Intronic
1018044861 6:159956834-159956856 CTCTAAGCTGGGCCTGGACAAGG - Intergenic
1018255295 6:161912431-161912453 ATCTGAGCTGGGCCTGTGACTGG + Intronic
1019247204 6:170716806-170716828 CTCTGAGCTGGGCCTGTCTCCGG - Intergenic
1019700027 7:2470320-2470342 CCCTGGGCTGGGCCTGTCCAGGG - Intergenic
1022968205 7:35493827-35493849 TTCAGAGCTGGGGCTGACCATGG - Intergenic
1024243470 7:47452930-47452952 TACTGTGCTGGGCCTGGGCAGGG + Intronic
1024301086 7:47888440-47888462 GGCAGAGCTGGGCCTGGTCAAGG + Intronic
1026067397 7:67087244-67087266 TTGTCTGCTGGGCCTGTTGAGGG + Intronic
1026678722 7:72449407-72449429 GTCTGAGCTGGCCCAGTGCAGGG - Intergenic
1026709522 7:72725083-72725105 TTGTCTGCTGGGCCTGTTGAGGG - Intronic
1030064958 7:105652481-105652503 TCCTGAGCGGAGCCTGTTCTGGG - Intronic
1033767256 7:144507094-144507116 TTCTGATTTTGGACTGTTCATGG - Intronic
1034782569 7:153894395-153894417 TTCTGAGCTTAGTATGTTCAAGG - Intronic
1035380130 7:158432735-158432757 TTCTGAGCTGGCCTTGCTCCTGG - Intronic
1035457005 7:159015224-159015246 GTATGAGCTGGGCCTGAGCAGGG + Intergenic
1035500932 8:91128-91150 CTCTGAGCTGGGCCTGTCTCCGG + Intergenic
1035854973 8:2964793-2964815 TTCTGACATGGGCGTGTTCTTGG - Intronic
1037913142 8:22756337-22756359 TCCTGAGCTGGGGCTGTCCGGGG - Intronic
1039306734 8:36271222-36271244 TTCTGAGCTGGGCATGTTGTGGG - Intergenic
1039437327 8:37568920-37568942 ATCTGAGCTGGGGCTGGGCATGG + Intergenic
1039756675 8:40530829-40530851 TCCTGAGCGGGCCCTGCTCAAGG + Exonic
1040414010 8:47181396-47181418 TTCTCAGCTGGGCCACTTCGAGG - Intergenic
1040536170 8:48312997-48313019 GTCTGAGCTGGGTTAGTTCAGGG + Intergenic
1041505817 8:58596539-58596561 TTCTGCGCTGGGCATGTGCTAGG - Intronic
1042194528 8:66221097-66221119 GTCTGAGTTGTGCCTCTTCATGG + Intergenic
1046623639 8:116554667-116554689 TTCTGAGACGTGACTGTTCAAGG - Intergenic
1047354541 8:124108027-124108049 TGCTGACCTGGGGCTGTTCTAGG - Intronic
1048326477 8:133443046-133443068 TCCTGAGCTGGGCCTGGTGGGGG - Intergenic
1049476298 8:142798418-142798440 TTCTGAGCAGTGCAGGTTCAGGG - Intergenic
1056730949 9:89166329-89166351 TTCTGTGCTAGGCCTGTGCTAGG - Intronic
1058735341 9:107888952-107888974 TTCTGCCCAGGGCCTGGTCAGGG + Intergenic
1060191730 9:121598358-121598380 TTCTGAGCCGGGACGGCTCAAGG + Intronic
1060779024 9:126398171-126398193 TCCTGGGCTGGGCCTGTGCTGGG + Intronic
1061673221 9:132201023-132201045 TTCTGACCTTGGACTGCTCAGGG + Intronic
1061994360 9:134176226-134176248 TGCTGAGCTGGGGCTGCTCATGG + Intergenic
1062104510 9:134746206-134746228 TCCCGAGCTGGGCCTGCCCAGGG + Intronic
1062112512 9:134789905-134789927 CTCTGAGCTGGCCTTGTCCACGG + Intronic
1203607978 Un_KI270748v1:72284-72306 CTCTGAGCTGGGCCTGTCTCCGG - Intergenic
1190936868 X:55005750-55005772 CTCTGTGCTGGGCCTGTGGAGGG - Intronic
1192017700 X:67349477-67349499 TTCAGAGCTGGGGCTGTTAAAGG - Intergenic
1192562892 X:72139183-72139205 TTCTGTGCTGGGCCTCTTGCTGG - Exonic
1192800438 X:74460250-74460272 TACTAAGGTGGGCCTGTTCTTGG + Intronic
1193016701 X:76741576-76741598 TTCTGAGCTGAGCCTCTCCTTGG - Intergenic
1193046957 X:77063938-77063960 GGCTGAGCTGGGCCATTTCATGG - Intergenic