ID: 1142885307

View in Genome Browser
Species Human (GRCh38)
Location 17:2908988-2909010
Sequence GAGCCACTGCGCCTTGTCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1564
Summary {0: 1, 1: 0, 2: 16, 3: 250, 4: 1297}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142885300_1142885307 11 Left 1142885300 17:2908954-2908976 CCTTGACCTCCCAAAGTGCTGGG 0: 2685
1: 87313
2: 209708
3: 234300
4: 151543
Right 1142885307 17:2908988-2909010 GAGCCACTGCGCCTTGTCGAGGG 0: 1
1: 0
2: 16
3: 250
4: 1297
1142885305_1142885307 1 Left 1142885305 17:2908964-2908986 CCAAAGTGCTGGGATTACAGGTG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
Right 1142885307 17:2908988-2909010 GAGCCACTGCGCCTTGTCGAGGG 0: 1
1: 0
2: 16
3: 250
4: 1297
1142885298_1142885307 14 Left 1142885298 17:2908951-2908973 CCGCCTTGACCTCCCAAAGTGCT 0: 1815
1: 60955
2: 150553
3: 159647
4: 96379
Right 1142885307 17:2908988-2909010 GAGCCACTGCGCCTTGTCGAGGG 0: 1
1: 0
2: 16
3: 250
4: 1297
1142885297_1142885307 18 Left 1142885297 17:2908947-2908969 CCTTCCGCCTTGACCTCCCAAAG 0: 31
1: 1455
2: 26090
3: 119797
4: 173062
Right 1142885307 17:2908988-2909010 GAGCCACTGCGCCTTGTCGAGGG 0: 1
1: 0
2: 16
3: 250
4: 1297
1142885304_1142885307 2 Left 1142885304 17:2908963-2908985 CCCAAAGTGCTGGGATTACAGGT 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122
Right 1142885307 17:2908988-2909010 GAGCCACTGCGCCTTGTCGAGGG 0: 1
1: 0
2: 16
3: 250
4: 1297
1142885302_1142885307 5 Left 1142885302 17:2908960-2908982 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1142885307 17:2908988-2909010 GAGCCACTGCGCCTTGTCGAGGG 0: 1
1: 0
2: 16
3: 250
4: 1297
1142885296_1142885307 22 Left 1142885296 17:2908943-2908965 CCATCCTTCCGCCTTGACCTCCC 0: 1
1: 3
2: 139
3: 885
4: 3296
Right 1142885307 17:2908988-2909010 GAGCCACTGCGCCTTGTCGAGGG 0: 1
1: 0
2: 16
3: 250
4: 1297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142885307 Original CRISPR GAGCCACTGCGCCTTGTCGA GGG Intronic