ID: 1142886102

View in Genome Browser
Species Human (GRCh38)
Location 17:2912879-2912901
Sequence AAGAACATGGAGATGTTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 360}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142886102 Original CRISPR AAGAACATGGAGATGTTGGC TGG Intronic
903334320 1:22614691-22614713 AAGAGCATGGGGATGGGGGCTGG - Intergenic
905120793 1:35680242-35680264 AAGAAAAAGGTGAAGTTGGCCGG - Intergenic
906377104 1:45304402-45304424 AAGAAAAGGGTGATTTTGGCTGG - Intronic
907913725 1:58849714-58849736 AAGATCATGGAGTTGGTGACTGG + Intergenic
909674491 1:78223982-78224004 AAGAACAGAGAGATGCTGCCTGG + Intergenic
909882569 1:80898652-80898674 AGGAAGGTGGAGATGGTGGCTGG - Intergenic
910109643 1:83668733-83668755 AAGATTCTGGAGATTTTGGCCGG - Intergenic
910433397 1:87180630-87180652 AATAACCTGGAGATGGTGCCTGG - Intergenic
910700065 1:90063805-90063827 AAGAAAATGGAGAACTTGGAGGG + Intergenic
910927768 1:92413737-92413759 TGGAACATGGATATGATGGCTGG + Intergenic
911248201 1:95543323-95543345 AGGAATATAGAGATGTTGGAAGG - Intergenic
911467644 1:98275299-98275321 AAGAACATGGAAATGTGGAGGGG + Intergenic
912011688 1:104973656-104973678 AAGCTCATGAAGATGTTGGCAGG + Intergenic
912019202 1:105084148-105084170 AAGTTTATGAAGATGTTGGCAGG - Intergenic
912567967 1:110602179-110602201 AAGAACAGGGATAGGTAGGCTGG + Exonic
912795499 1:112690654-112690676 AAAAAAACAGAGATGTTGGCTGG - Intronic
915028764 1:152858158-152858180 AAGAGGGTGGAGATGATGGCTGG - Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916650182 1:166828024-166828046 AAGAACAAAGGGATTTTGGCTGG + Intergenic
916661024 1:166922267-166922289 AAAAAGATGGAGATGATGGGTGG + Intronic
916840771 1:168598179-168598201 AAGCATAATGAGATGTTGGCAGG - Intergenic
916933048 1:169599755-169599777 AAAAAAATGGAGATGTCAGCTGG + Intronic
917591158 1:176478498-176478520 AAGAACATGAAGTATTTGGCAGG + Intronic
917794642 1:178524112-178524134 TAGAACATGGACATCTTTGCAGG + Intronic
918318586 1:183343918-183343940 AAGAAAGTAGGGATGTTGGCTGG - Intronic
918613518 1:186518187-186518209 AAGAACATGAAGTTGATGGTGGG + Intergenic
920791333 1:209095884-209095906 AACAACAAGGAGCTGTTTGCAGG - Intergenic
921055479 1:211539422-211539444 AAGGACGTGGAGATTTGGGCAGG - Intergenic
921131225 1:212221695-212221717 AAGACAATGGAGAAGGTGGCTGG + Intergenic
922671892 1:227515645-227515667 AAGAAAATGAAGAAGTTAGCAGG - Intergenic
923212362 1:231815440-231815462 AAAGACATGTACATGTTGGCTGG + Intronic
1062873729 10:929640-929662 ACAAACATGGAAATGTTGTCTGG - Intronic
1063847246 10:10144336-10144358 AAGATGAAGGAGATGGTGGCTGG - Intergenic
1064301990 10:14131062-14131084 AAGAACATGGAGGTGTTACCTGG - Intronic
1064320403 10:14299317-14299339 AAGAACATGGCCACGTGGGCTGG + Intronic
1064763286 10:18644538-18644560 AAGTACAAGAAAATGTTGGCCGG + Intronic
1065402876 10:25326135-25326157 GAGCACATGGACATGTGGGCAGG - Intronic
1066762643 10:38770308-38770330 ACTAACATCAAGATGTTGGCAGG - Intergenic
1067957524 10:50808658-50808680 AAGAACATGGAGATGCTCTGTGG - Intronic
1068449968 10:57173628-57173650 TATAACATGGAGCTGTTGTCTGG - Intergenic
1069536674 10:69258811-69258833 AGGAACATCGAGATGGTGGAGGG + Exonic
1069555007 10:69392160-69392182 AAGAACGTGGAGATGGTGGAGGG + Exonic
1069992635 10:72324727-72324749 AAGAATTTGAAGATTTTGGCCGG - Intergenic
1072229967 10:93406443-93406465 AGGAAGGTGGAGATGTTTGCTGG + Intronic
1073816140 10:107209466-107209488 ATGAAAATTGAGGTGTTGGCAGG - Intergenic
1075048384 10:119164339-119164361 GAGAACCTGGAGAGGTTGGGAGG - Intronic
1077921376 11:6644325-6644347 GGGACCATGGAGAAGTTGGCAGG - Intronic
1078116530 11:8457924-8457946 AATAACATGGAGAACTTGGTAGG + Intronic
1078543083 11:12226947-12226969 TATAACAAGGAGGTGTTGGCTGG - Intronic
1079301834 11:19285379-19285401 AAGAAGATGCAGATTTGGGCCGG + Intergenic
1079333348 11:19551227-19551249 AAGAACATGTGCAGGTTGGCAGG + Intronic
1079345275 11:19646328-19646350 AAGAAAATGGAGGTGTGGGATGG + Intronic
1079746229 11:24134183-24134205 AAGTTCATGGAGATGTTGCATGG - Intergenic
1080436336 11:32248343-32248365 AAAAAAATGTAGATGTGGGCCGG - Intergenic
1081220687 11:40456873-40456895 AAGAGCATGGAGATAAGGGCGGG + Intronic
1081423530 11:42900108-42900130 AAGAACATGGAGAGGATTCCTGG - Intergenic
1082691695 11:56312725-56312747 AAGAAAGTGGACATGGTGGCAGG + Intergenic
1084709437 11:70834975-70834997 AAGAACATGGCTATTTTGGGGGG + Intronic
1085251531 11:75147315-75147337 AAGAGCCTGGAGGTGGTGGCTGG + Intronic
1085669048 11:78444417-78444439 ATCAAAATGGAGATGATGGCTGG + Intronic
1085867149 11:80307914-80307936 GAGAAAATGGAGTTGTTGGTGGG + Intergenic
1085971373 11:81595402-81595424 ATGAAAATGCAGATCTTGGCTGG + Intergenic
1086338968 11:85827559-85827581 TAGAATATGGAGGAGTTGGCAGG - Intergenic
1086719820 11:90105991-90106013 ACTAACATCAAGATGTTGGCAGG - Intergenic
1087530490 11:99375004-99375026 AAGAAAATGGAGAGCTAGGCCGG + Intronic
1089417241 11:118302367-118302389 AAAAAGATGGAGATTTGGGCAGG - Intergenic
1089569039 11:119390273-119390295 AAGGACGTGAAGATGCTGGCGGG - Intergenic
1089702416 11:120253553-120253575 AAGAACTTAGAAATGTTGGCTGG - Intronic
1091562163 12:1623077-1623099 AAGAGGATGGAAAGGTTGGCGGG + Intronic
1091939699 12:4467606-4467628 TAGAACATGGACATCTTGGGGGG - Intergenic
1092454734 12:8633209-8633231 AAGAATTTGGAGCTGCTGGCCGG - Intergenic
1092762382 12:11821538-11821560 ATCAAAATGGAGATGTTGACCGG + Intronic
1092764713 12:11842100-11842122 AAGAAGAAGGAGATGTAGGCTGG + Intronic
1094207790 12:27858989-27859011 TAGAAAATGGAGATGGGGGCCGG + Intergenic
1094819591 12:34214196-34214218 AGGAACTTGGAGGTGTGGGCGGG + Intergenic
1095533142 12:43214310-43214332 ATAAACATGGAGATGATGACGGG - Intergenic
1095729708 12:45493285-45493307 TAGAACATGGATATATTTGCAGG + Intergenic
1095851406 12:46811381-46811403 AAGAACAAATAGAAGTTGGCAGG + Intronic
1095866934 12:46982886-46982908 ATGAAGATGGAGATGTTGTGAGG + Intergenic
1096129652 12:49147660-49147682 TAGAACATGGACAAGATGGCTGG + Intergenic
1097623496 12:61971194-61971216 AAGAAAATGGAAATGTTATCTGG + Intronic
1098050329 12:66446237-66446259 AATAAGATGGAGATGTCTGCTGG - Intronic
1098964004 12:76766721-76766743 CAGAAAATGGAGATCCTGGCTGG + Intronic
1098978919 12:76934043-76934065 AGTAAAATGGAGATATTGGCTGG + Intergenic
1099772039 12:87073299-87073321 AAGCTCATGTAGTTGTTGGCAGG + Intergenic
1100740880 12:97591101-97591123 AAGAACATGGATGTGTTGCATGG - Intergenic
1103770122 12:123315929-123315951 AAGAACATGAAGATGGAGGGAGG + Intronic
1104894975 12:132159579-132159601 CAGGGCATGGAGATGTGGGCGGG + Intergenic
1106024355 13:25942718-25942740 AAGAAAATCGATAAGTTGGCTGG - Intronic
1106399937 13:29419856-29419878 ATGAACATAATGATGTTGGCTGG - Intronic
1106672668 13:31923382-31923404 AAAAACATGGAGATGTTCTTTGG - Intergenic
1108245745 13:48511681-48511703 AAAAACATAGATTTGTTGGCAGG - Intronic
1111090422 13:83439119-83439141 AAGAACATGGATTTTTGGGCAGG - Intergenic
1111495407 13:89042548-89042570 AGGAACATGGAGATATTCCCTGG + Intergenic
1113869557 13:113550556-113550578 AACAAGATGGAGGTGCTGGCAGG + Intronic
1114831514 14:26148275-26148297 AAGAAAAAACAGATGTTGGCAGG + Intergenic
1115394165 14:32888903-32888925 ATGAAAATGGAAATATTGGCTGG + Intergenic
1116638275 14:47426123-47426145 GAGAACATGGACATTTTGGCGGG + Intronic
1116823034 14:49644176-49644198 AAGGACATATAGTTGTTGGCCGG - Intronic
1117643135 14:57821959-57821981 AGGGACATGGACATGTAGGCAGG - Intronic
1117763527 14:59058053-59058075 AAAAACTTGGAGAGGTTGGGTGG - Intergenic
1118010247 14:61603519-61603541 TATAAAATGGAGTTGTTGGCTGG + Intronic
1118487743 14:66229811-66229833 AAGAACTTGGAGATGCAGGTCGG - Intergenic
1119447277 14:74676620-74676642 AAGGACATGGAATTGTTGGTGGG + Exonic
1120510783 14:85411789-85411811 AAGAAGAAGGAAATGTTGGCAGG + Intergenic
1120968803 14:90190817-90190839 AAGTGCATGGAGATGGTGACCGG - Intergenic
1122273446 14:100578686-100578708 TAGAACATGGAAGTGATGGCTGG + Intronic
1202933974 14_KI270725v1_random:66567-66589 ACTAACATCAAGATGTTGGCAGG - Intergenic
1123979042 15:25582568-25582590 TATAACAAGGAAATGTTGGCCGG + Intergenic
1125625371 15:41104400-41104422 ATTAACATGAAGCTGTTGGCAGG - Intronic
1126013501 15:44326946-44326968 AAAAAAAAGCAGATGTTGGCTGG - Intronic
1127828984 15:62733160-62733182 AAGAACATGGAGCTGTGGAGAGG + Intronic
1129746772 15:78027455-78027477 AATAACATGGACAAGTTGGAGGG + Intronic
1130045739 15:80443305-80443327 AAGAACAAGTTGATGATGGCAGG + Intronic
1130095191 15:80850570-80850592 AATAACAAGAAGATGATGGCTGG - Intronic
1130217721 15:81987901-81987923 AAGATGATGAAGGTGTTGGCAGG - Intergenic
1131504032 15:92999961-92999983 AGGAATATGGATATTTTGGCTGG + Intronic
1131676359 15:94674453-94674475 AAGCAAGCGGAGATGTTGGCTGG - Intergenic
1132504706 16:301963-301985 AAGAATATGGACATGTCCGCAGG - Intronic
1135746316 16:25019828-25019850 AAGAAAATGGAAGTGTGGGCCGG + Intergenic
1136283800 16:29229898-29229920 AAGACCAGGGACATGTGGGCCGG - Intergenic
1136777230 16:32878522-32878544 CAGAACCTGGAGAGGTGGGCAGG + Intergenic
1137673693 16:50293378-50293400 ATGCCCATGGAGATGTGGGCCGG - Exonic
1137809199 16:51336597-51336619 AAGAAAATGGAGATGGTGATGGG - Intergenic
1137819637 16:51431603-51431625 GAAAACATGGAGACGGTGGCTGG + Intergenic
1141093233 16:81144802-81144824 TAGAAAATAGAGGTGTTGGCTGG - Intergenic
1141147078 16:81538481-81538503 AAGAACATGGAGACACAGGCTGG - Intronic
1141838548 16:86559394-86559416 AAGAACATGGAGTCTGTGGCCGG + Intergenic
1142088834 16:88199409-88199431 AAGACCAGGGACATGTGGGCCGG - Intergenic
1142499692 17:325373-325395 AGGAAGATGGAGAGGTAGGCAGG - Intronic
1142732233 17:1867732-1867754 AAGAAGATGGAGATGATGAAAGG + Intronic
1142886102 17:2912879-2912901 AAGAACATGGAGATGTTGGCTGG + Intronic
1143454007 17:7054082-7054104 AATGGCATGGAGATGTGGGCAGG - Intergenic
1143830981 17:9650686-9650708 AAAAACATAGGTATGTTGGCCGG - Intronic
1144940133 17:18933198-18933220 AAGAACATGAAGATGAGTGCTGG + Intergenic
1145901998 17:28495548-28495570 AATACCAGGGAGATGTTAGCAGG + Intronic
1146264932 17:31446549-31446571 AAGAGGATGGAGATGTGGCCTGG - Intronic
1146758755 17:35456715-35456737 AAGAATCTGAAGATGTAGGCTGG - Intergenic
1147170836 17:38617807-38617829 AAGAACATGTAGCTATGGGCAGG + Intergenic
1147370419 17:39988908-39988930 AAGAACCTGTAGATGTAAGCAGG + Intronic
1148481706 17:47963887-47963909 AAGAAAATGGTCATTTTGGCTGG - Intergenic
1148528733 17:48368332-48368354 AAGAATTGGAAGATGTTGGCAGG - Intronic
1148990289 17:51660213-51660235 AAGACCATGGAGAGCTTGGCAGG + Intronic
1149795820 17:59518708-59518730 TAGAAGATGTATATGTTGGCCGG + Intergenic
1150104318 17:62451036-62451058 AAAAACATGATTATGTTGGCTGG + Intergenic
1151000046 17:70365048-70365070 AATAATATGGAGATGTTTTCTGG - Intergenic
1151423695 17:74015884-74015906 AGGAGCCTGGAGAGGTTGGCAGG + Intergenic
1151521092 17:74630231-74630253 CAGAAAATGCAGATGGTGGCCGG + Intergenic
1152350893 17:79783704-79783726 AAGATAAAGGAGAAGTTGGCTGG - Intronic
1153008822 18:519429-519451 AGGAACATGGGGCTGCTGGCAGG - Intergenic
1153264501 18:3256538-3256560 AATAAAGTGGAAATGTTGGCAGG - Intergenic
1153318573 18:3749447-3749469 AAATAGAAGGAGATGTTGGCCGG - Intronic
1153348019 18:4049481-4049503 TAGAACAGGGATATGGTGGCAGG - Intronic
1153725719 18:7952707-7952729 AAGAAAATGTAAATGTTGGCCGG + Intronic
1154195703 18:12264847-12264869 TAGAAAGTGGAGAAGTTGGCCGG - Intronic
1157209609 18:45730617-45730639 AAAAAAATGGAGAGGTTTGCAGG - Intronic
1157211454 18:45746087-45746109 AACAACATTGAGATGTTCTCTGG - Intronic
1158664587 18:59420954-59420976 AAGAACATGGGGATGCTGGCTGG + Intergenic
1159977877 18:74738441-74738463 AAAAAAAAGGAGAAGTTGGCCGG + Intronic
1161424205 19:4193540-4193562 ATGTAAATGGAGATGATGGCAGG + Intronic
1161625675 19:5325171-5325193 TGGAATATGGAGATGATGGCAGG - Intronic
1161806383 19:6445603-6445625 TATAAAATCGAGATGTTGGCAGG - Intronic
1161866948 19:6839986-6840008 TAGAAAATGGTTATGTTGGCCGG - Intronic
1161968130 19:7560433-7560455 AAGAACATGGAGAGATTGATTGG + Intronic
1163486127 19:17587320-17587342 AAGAACTTGGAGGTGATGCCTGG + Intergenic
1163523986 19:17809128-17809150 ATAAACAAGGAGATGTTGGCCGG - Intronic
1163630652 19:18416615-18416637 AAGAAGAGGGGGATGATGGCAGG - Intergenic
1163819192 19:19486568-19486590 AAGGAAATGGAGTTGTTTGCCGG - Intronic
1165674543 19:37710166-37710188 AAGAAAATGGAGTGGATGGCCGG + Intronic
1165702591 19:37949780-37949802 AAGAACATGGCCACATTGGCCGG + Intronic
1168709445 19:58490324-58490346 TAAAACATGGAGCTCTTGGCGGG + Intronic
925463169 2:4082706-4082728 AAGCACATGGGGGTGTGGGCTGG - Intergenic
926773994 2:16404150-16404172 ATGAGGATGGAGATGTTGACTGG + Intergenic
927291580 2:21409591-21409613 TAGAACATGGACATCTTTGCAGG + Intergenic
927829695 2:26338839-26338861 AAGAAAATGAAGTTGTTGGCTGG + Intronic
928118524 2:28565196-28565218 AAGAACATAGACCTTTTGGCAGG + Intronic
928420779 2:31136917-31136939 AAAAACAGGAAGATGTGGGCGGG - Intronic
928449603 2:31366766-31366788 AGGAAGAGGGAGATGTGGGCTGG - Intronic
929298038 2:40270740-40270762 TAGAACATGGACATCTTGGGTGG + Intronic
929754911 2:44756395-44756417 AAAACCATGGAGTTGTTGTCTGG - Intronic
931334790 2:61328550-61328572 TAGAACAGAGAGATGTTGTCTGG - Intronic
932360131 2:71098044-71098066 AAGCTCATGGGGTTGTTGGCAGG + Intergenic
932584445 2:73017697-73017719 ATGAACATCGAGATGTTTGATGG + Intronic
932701998 2:73998432-73998454 ACGAAGATGGAGTTGTTGGCTGG + Intronic
933010231 2:77052463-77052485 ATGAAAAGGGAGATGTCGGCTGG - Intronic
933032567 2:77350024-77350046 AAGAAATTGGAAATGCTGGCCGG + Intronic
934035484 2:88085440-88085462 AAGGAGATGGAGATGGTGACTGG + Intronic
934307286 2:91837782-91837804 AATAACATCAAGATGTTGGCAGG + Intergenic
934325971 2:92014931-92014953 AATAACATCAAGATGTTGGCAGG - Intergenic
934464322 2:94245581-94245603 AATAACATCAAGATGTTGGCAGG - Intergenic
934582054 2:95450543-95450565 AAGAATATGGCGATGATGGGAGG - Intergenic
934597396 2:95626171-95626193 AAGAATATGGCGATGATGGGAGG + Intergenic
934842492 2:97636823-97636845 AAGAATATGGCGATGATGGGAGG - Intergenic
936477392 2:112851246-112851268 AAGAAAATGGAGAAGGTGCCAGG + Intergenic
936533317 2:113291818-113291840 AAGGCCATGTAGATGGTGGCAGG + Intergenic
937352685 2:121176162-121176184 AAGAAAACTGAGTTGTTGGCCGG - Intergenic
940347491 2:152642708-152642730 AAGAACTTGGAGTTCCTGGCTGG + Intronic
942600940 2:177640421-177640443 GAGAACATGCAAATGGTGGCAGG + Intronic
943319108 2:186425179-186425201 AAGAATCTGGAAATGTGGGCAGG + Intergenic
944185157 2:196940155-196940177 AACAAAATGAAGATGTTTGCTGG + Intergenic
945689142 2:213010637-213010659 AAGAACCTGGATATGCAGGCTGG + Intronic
945812015 2:214560222-214560244 AAAACCATGGAAATGTTAGCAGG + Intronic
946169713 2:217887602-217887624 AAGAACTAGGGGATGTTGGCTGG - Intronic
946733576 2:222732129-222732151 AACTACATGGAGATGATGGGTGG + Intergenic
947468573 2:230378370-230378392 TAGAACATGGACATTGTGGCTGG - Intronic
947879203 2:233490466-233490488 AAGAAAAAGCATATGTTGGCTGG - Intronic
948926124 2:241099369-241099391 AAGAAGTTGCAGATTTTGGCTGG - Intronic
1169625067 20:7557017-7557039 AAGAATGAGGAGATGTTGGATGG - Intergenic
1169892618 20:10470042-10470064 AGGAACCTGGAGATGATGGTCGG + Intronic
1172012278 20:31852512-31852534 TAGAAGTTGGAGATGTTGGCCGG + Intronic
1174506456 20:51020816-51020838 AAGAACAAAGAGATGTGTGCTGG - Intronic
1174666676 20:52264664-52264686 AAAAACATGGTGATGTTGGCTGG + Intergenic
1175015596 20:55786688-55786710 AAGAATATGGAGTTGTTTTCTGG + Intergenic
1176595377 21:8688724-8688746 ACTAACATCAAGATGTTGGCAGG - Intergenic
1177288678 21:19082223-19082245 AATAAAATTGGGATGTTGGCCGG - Intergenic
1177659335 21:24062619-24062641 TAGAAAATGGAGATGGTGGTCGG - Intergenic
1178142494 21:29699943-29699965 AAAAAAAAGAAGATGTTGGCTGG - Intronic
1178517272 21:33258480-33258502 AAAAATATCAAGATGTTGGCAGG - Intronic
1179080741 21:38168638-38168660 AAGAACATGGAGAACTTCCCAGG - Intronic
1179096561 21:38321225-38321247 AAGGAGATGGAAATGTTGACAGG - Intergenic
1179718402 21:43301874-43301896 AATCACAGGGAGATGGTGGCTGG + Intergenic
1180278233 22:10665876-10665898 ACTAACATCAAGATGTTGGCAGG - Intergenic
1180585483 22:16884724-16884746 ACTAACATCAAGATGTTGGCAGG - Intergenic
1181090858 22:20471597-20471619 AAGAACCTGGCGCTGGTGGCAGG + Intronic
1182189386 22:28442931-28442953 TGGAACATCAAGATGTTGGCTGG + Intronic
1182366414 22:29782345-29782367 AATAAACTGGAGATGTTGGCAGG - Intergenic
1183380261 22:37487113-37487135 AACAAGATGGAGGTGGTGGCTGG - Intergenic
1183396138 22:37571894-37571916 AAGAACATGGACATGAAGCCGGG - Exonic
1184242229 22:43217254-43217276 ATCCACATGGAGATGTTGGATGG - Intronic
949510250 3:4760970-4760992 TAGAACATGGACATGTCTGCGGG + Intronic
950361380 3:12451829-12451851 AAGTACATGTGGTTGTTGGCGGG + Intergenic
950404492 3:12796435-12796457 AATAACAAGGAGGTGGTGGCAGG + Intergenic
951901619 3:27663313-27663335 AAGAACATGGAAATTTTTTCTGG + Intergenic
952286006 3:31970377-31970399 TAGAATATGGAAATGATGGCTGG - Intronic
952642781 3:35617642-35617664 AGCAACATGAAGATGTAGGCTGG - Intergenic
954257855 3:49418799-49418821 TAGAAACTGCAGATGTTGGCCGG - Intronic
955140806 3:56267473-56267495 TAAAACAGGGAGATGTTGGCAGG + Intronic
956443665 3:69304792-69304814 AAGAACATGCTGATGGTGGTGGG + Intronic
958434970 3:94085458-94085480 AAGAAGATGGAAATGTTGGCTGG + Intronic
959333565 3:105036654-105036676 GAGAACCTGGAAATGTAGGCAGG + Intergenic
959644516 3:108682628-108682650 AAGCACAGGGAGAGGTTGGTTGG + Intronic
962137828 3:132756274-132756296 AAGAAGCTGGAGATGTGAGCAGG + Intergenic
962872215 3:139507310-139507332 AAAAAAATCGAGATGTTGGCAGG + Intergenic
963685979 3:148434484-148434506 ATAAAGATGGAAATGTTGGCTGG + Intergenic
964754692 3:160082871-160082893 AAGAACAGGTAGATATTGGTGGG - Intergenic
965119510 3:164534466-164534488 AATAACATGCAGACATTGGCTGG + Intergenic
966790691 3:183666855-183666877 AAGCAGATGGAGATGGGGGCAGG - Intronic
967075520 3:185998243-185998265 AAACACATGGAGGTGTTTGCTGG - Intergenic
967148432 3:186626436-186626458 AAGGAGATGCAGATGTTGGATGG - Intergenic
967237750 3:187403556-187403578 AAGAACTAGGAGATGGTGTCAGG + Intergenic
967485899 3:190030274-190030296 AAAAACAATGAGATTTTGGCTGG + Intronic
967754129 3:193149478-193149500 AAGAACCTGGAGCTCTGGGCAGG - Intergenic
967957034 3:194885267-194885289 CAGAAAATGGAAATGTTAGCTGG + Intergenic
968875717 4:3266760-3266782 AAAAAAGTGGAGATATTGGCCGG + Intronic
969939014 4:10711944-10711966 CTGAACATGGAAATATTGGCTGG + Intergenic
970599004 4:17626242-17626264 AAGAAAAAGGAGATGTTGAATGG + Exonic
970772323 4:19628774-19628796 AAGAAACTGGACATGTTGACTGG + Intergenic
973553479 4:52058486-52058508 AAGGACATTTAGAGGTTGGCAGG - Intronic
973691549 4:53438255-53438277 AGGAAGATGGAGGTGTTGGGAGG + Intronic
975161646 4:71131478-71131500 TAGAACCTTGAAATGTTGGCAGG - Intergenic
976021884 4:80639364-80639386 AAGAACATGGAGATGTTTTTTGG + Intronic
976942996 4:90729577-90729599 AAGAACATATATATATTGGCCGG + Intronic
977701633 4:100029060-100029082 AACAACATGGCCATGGTGGCAGG - Intergenic
977861081 4:101960621-101960643 AAGAACATGGAGATGGTTAGTGG + Intronic
978435662 4:108681842-108681864 ATGAAAGTGGAGCTGTTGGCCGG + Intergenic
978847387 4:113289975-113289997 CAGTACAGTGAGATGTTGGCAGG + Intronic
978883772 4:113741781-113741803 AAGTACATGATGATGTTGGGAGG - Intronic
981138796 4:141242886-141242908 AAGAATAAAGAGAAGTTGGCTGG - Intergenic
981589629 4:146345438-146345460 AAAAAGATGGAAATGTAGGCAGG - Intronic
981780047 4:148418993-148419015 AAGAGTGTGTAGATGTTGGCAGG - Intronic
982639439 4:157939154-157939176 AAGAACATAAAGATTTTGGTTGG - Intergenic
983555308 4:169054269-169054291 AAAAATATGGAGATGTAGCCGGG - Intergenic
983747624 4:171221304-171221326 AACAACATGCACATGTTAGCTGG - Intergenic
985476535 5:82451-82473 AAGAACAGGTAGATTTTTGCTGG + Intergenic
986237720 5:5927475-5927497 AAGCACTTGGAGATGCTGGTTGG + Intergenic
986426080 5:7633132-7633154 AAAAAAATGGACATTTTGGCAGG + Intronic
987206802 5:15635677-15635699 ATGAAGATGGAGAAGTAGGCAGG + Intronic
987724607 5:21681375-21681397 AAAAAGATGGAAGTGTTGGCTGG - Intergenic
988075246 5:26343998-26344020 TAGAAGATCAAGATGTTGGCAGG + Intergenic
988211078 5:28204294-28204316 AAGTACAAAGAGAAGTTGGCCGG - Intergenic
988781750 5:34528852-34528874 AAGATCATCCAGATGTTGGCAGG - Intergenic
988960568 5:36367060-36367082 AACACCCTGGAGATGTTGGAAGG - Intergenic
991461639 5:66864779-66864801 TCTAACATGAAGATGTTGGCAGG - Intronic
991921094 5:71657720-71657742 AAGAATAAGGAGATGTGGTCAGG - Exonic
993166091 5:84356687-84356709 AAGGACATGGACATCTTTGCAGG + Intronic
993297715 5:86163822-86163844 AAAAAAATTAAGATGTTGGCAGG + Intergenic
995259892 5:110091243-110091265 AAGAACAAGGATATTTTGGGAGG + Intergenic
996200102 5:120661951-120661973 AAGAGCTTGGAAATGTGGGCTGG + Intronic
996319144 5:122194245-122194267 GACAAGATGGAGATGTTGACCGG + Intergenic
996384409 5:122895698-122895720 AGGAACATGGTGAGGGTGGCAGG - Intronic
996595223 5:125193234-125193256 ACCAACATGGAGATGTAGGTTGG - Intergenic
998788071 5:145734100-145734122 AAAAAAATCAAGATGTTGGCAGG - Intronic
998928509 5:147155013-147155035 AAGAACACGCAGCTGTTGACAGG - Intergenic
1000040174 5:157479495-157479517 AAGCACCTGGAGATGTTTGCTGG - Exonic
1001052582 5:168424867-168424889 AAGAACATTTTGGTGTTGGCCGG + Intronic
1003176212 6:3753437-3753459 AAGGACTTAGAAATGTTGGCTGG - Intergenic
1003273617 6:4629036-4629058 AAGAAAATGAAGATGTAGGCTGG - Intergenic
1006334195 6:33411864-33411886 AAGAAAATGGGGAGGCTGGCCGG + Intronic
1006360423 6:33584251-33584273 AAGGACAGGGAGATGTGGGTGGG + Intergenic
1006393161 6:33770777-33770799 AAGAACAGGGTGAGGTTGGATGG - Intergenic
1007513388 6:42391765-42391787 CAGAACATGGAGCAGTGGGCTGG + Intronic
1008970864 6:57366433-57366455 AAGGACATGGAGATGTGGTTGGG + Intronic
1009159826 6:60268235-60268257 AAGGACATGGAGATGTGGTTGGG + Intergenic
1010548761 6:77192783-77192805 AAGAACAAGTAGGTATTGGCTGG + Intergenic
1011607304 6:89117847-89117869 ATGAACAGGGAGGTGTTGGGGGG + Exonic
1012121141 6:95367953-95367975 AAGAACATGGATATCTTTGGGGG - Intergenic
1012553578 6:100486379-100486401 AATAACATGTAGAGGTTAGCTGG - Intergenic
1012687430 6:102269381-102269403 AAGTACATAGAGATTTTGTCAGG - Intergenic
1013613206 6:111815199-111815221 GAGAACATGGAGGTGTTGCTGGG - Intronic
1013742328 6:113301767-113301789 AAGAACATGCAGAATTTTGCAGG + Intergenic
1015340703 6:132096992-132097014 AACAACAGGGTGATGTTGGGAGG + Intergenic
1015545999 6:134362104-134362126 ACAAATATGGGGATGTTGGCAGG - Intergenic
1015776645 6:136821506-136821528 AAGAAGATGGAGATCTTTGTAGG - Intergenic
1017425479 6:154316152-154316174 AAGAATTTGCACATGTTGGCTGG - Intronic
1018534914 6:164809679-164809701 AAAAACATGGTCATGGTGGCAGG - Intergenic
1018879323 6:167860966-167860988 CAGAGCATGGTGATGTAGGCAGG + Intronic
1020861658 7:13500556-13500578 AAGAACATGAAGATATTTCCAGG - Intergenic
1021825555 7:24547282-24547304 AAGAAGCTGGAGATGTTGTGTGG + Intergenic
1021871382 7:25009807-25009829 AAGAAAATGAAGATGTAGGTGGG - Intergenic
1022286769 7:28961085-28961107 AAGAATCTGGAGATGCAGGCTGG + Intergenic
1023071149 7:36435369-36435391 AAGAAAATAGAGATGGTGGGGGG + Intronic
1023174162 7:37419335-37419357 AAGAAGATGGAGATGCTATCTGG + Intronic
1024491727 7:49993818-49993840 AACAACATGGCCATGGTGGCGGG - Intronic
1024543975 7:50501775-50501797 ATAAAAATGGAAATGTTGGCCGG + Intronic
1024760606 7:52592410-52592432 AAGAAAATCTAGATTTTGGCTGG + Intergenic
1025243163 7:57294850-57294872 TAGAATATGGAAATGTTGGCTGG + Intergenic
1026168543 7:67932562-67932584 TAGAATATGGAAATGTTGGCTGG + Intergenic
1027473679 7:78603815-78603837 AAGAAAATAGAAATATTGGCTGG - Intronic
1027488228 7:78788403-78788425 AATAAAATGGAAATGTTGGATGG - Intronic
1028921171 7:96312033-96312055 AAGACCAAGGAGATTTTAGCTGG + Intronic
1029469296 7:100744011-100744033 AAGAACAAAGAGATATAGGCTGG - Intronic
1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG + Intergenic
1030285717 7:107824836-107824858 TAGAACATGGACATCTTTGCAGG - Intergenic
1030835942 7:114285426-114285448 AAGAAAATGGAGAAGTTTGTGGG + Intronic
1032033495 7:128504224-128504246 AAAAACATGATTATGTTGGCTGG + Intronic
1034102155 7:148459133-148459155 AAGAACCTGGATATTTAGGCCGG - Intergenic
1034851327 7:154496736-154496758 AAGAACTTGGAAATGTGTGCTGG + Intronic
1036748484 8:11427633-11427655 AAGAACATTGAGATGCTCGCTGG - Intronic
1036931984 8:12965351-12965373 CAGAGCATAGAGATGGTGGCAGG + Intronic
1037920471 8:22802081-22802103 AAGAATCTGGAGATGCTGGGAGG - Intronic
1038510315 8:28128175-28128197 AAGAATTGAGAGATGTTGGCCGG + Intronic
1038574347 8:28691599-28691621 ACTAATATGTAGATGTTGGCCGG + Intronic
1038827385 8:31019627-31019649 AAGAAAAAAGAGATATTGGCTGG - Intronic
1039109715 8:34028538-34028560 AAGTACAGGGAGATGTTTCCAGG - Intergenic
1039351988 8:36773090-36773112 AAGATCATGGTGATGTTAGAAGG - Intergenic
1039365062 8:36920528-36920550 AAGAACCTGGACAAGCTGGCAGG - Intronic
1039794880 8:40904274-40904296 AAAAGCATTGAGATGGTGGCAGG + Intergenic
1040430647 8:47338596-47338618 AAGAACTTAGAGATGGTGCCTGG + Intronic
1040691654 8:49945851-49945873 AAGAACAAGGGGATATTTGCTGG + Intronic
1040921576 8:52626384-52626406 ATGAACATGGAAATGTTGAAAGG + Intronic
1041773370 8:61496882-61496904 TAGAAAGTGGAGATGTTGACAGG - Intronic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1042142062 8:65688846-65688868 AAGAATATGTATATGTGGGCTGG + Intronic
1042776720 8:72440324-72440346 AAGAACATGGAAAATTTGGCAGG - Intergenic
1043072820 8:75660965-75660987 AAGAATTTGGGGAGGTTGGCTGG + Intergenic
1043506876 8:80911123-80911145 GAGGACAAGGAGATGTTGACGGG + Intergenic
1045784879 8:105909216-105909238 TAGAACATGGAGATTTTGTGGGG - Intergenic
1048946899 8:139456970-139456992 TAGAACATGGACATCTTGGTGGG + Intergenic
1049212644 8:141393747-141393769 CAGAACATGGTGAGGGTGGCTGG + Intronic
1049536601 8:143185531-143185553 AACCAGAGGGAGATGTTGGCTGG - Intergenic
1051627994 9:19116510-19116532 AAGCACATGGGGGTGATGGCAGG - Exonic
1053694407 9:40622353-40622375 ACTAACATCAAGATGTTGGCAGG - Intergenic
1053941399 9:43252759-43252781 AATAACATCAAGATGTTGGCAGG - Intergenic
1054270428 9:63017775-63017797 ACTAACATCAAGATGTTGGCAGG + Intergenic
1054305652 9:63421577-63421599 ACTAACATCAAGATGTTGGCAGG - Intergenic
1054404399 9:64745564-64745586 ACTAACATCAAGATGTTGGCAGG - Intergenic
1054438021 9:65231059-65231081 ACTAACATCAAGATGTTGGCAGG - Intergenic
1054492383 9:65790901-65790923 ACTAACATCAAGATGTTGGCAGG + Intergenic
1056620963 9:88214255-88214277 AAAAAAAAGGAGATCTTGGCCGG - Intergenic
1059101154 9:111472792-111472814 AAAAACATGAAGATCTTGGGGGG + Intronic
1059750434 9:117242455-117242477 CAGAACAGGGATATGCTGGCTGG + Intronic
1059777949 9:117494835-117494857 AAAAACATGGAGATTATGGATGG + Intergenic
1060873105 9:127058456-127058478 AGGAGCAAGGGGATGTTGGCAGG + Intronic
1061025925 9:128049461-128049483 AAGAAAGTGGAGAAGTTGGCCGG + Intergenic
1061162466 9:128903097-128903119 AATAGCAGGGGGATGTTGGCAGG + Intronic
1061236118 9:129343574-129343596 AGGAGGATGGAGATGTGGGCAGG + Intergenic
1062158285 9:135066218-135066240 GAGAACATGGAGATCTTGGAGGG - Intergenic
1186329507 X:8517268-8517290 AAGAGCATGAAGATGTTAGGGGG + Intergenic
1187695244 X:21913000-21913022 AAGAAATTGGAGAAGATGGCCGG - Intergenic
1188801726 X:34539705-34539727 AAGAACATGAGGATGTTCTCAGG - Intergenic
1189140703 X:38602682-38602704 AAGAGAATGGAGAGGTGGGCGGG + Intronic
1189354812 X:40302474-40302496 AATAGCAAGGAGATCTTGGCTGG + Intergenic
1189536312 X:41938747-41938769 AAGGACATGGACATCTTGGTGGG + Intergenic
1190570869 X:51779932-51779954 AAGATCCTGGAGAGGTAGGCAGG - Intergenic
1190579188 X:51874019-51874041 AAGGAAAAGGAGATGTTGGTAGG + Intronic
1191795055 X:65012843-65012865 ACGAATATGGATATGATGGCCGG - Intronic
1192604592 X:72502624-72502646 AAGAAAATAGATATTTTGGCCGG + Intronic
1194696788 X:97062515-97062537 AAGGACAGGGAGATGGTGTCAGG + Intronic
1196752469 X:119130273-119130295 AAGAACATGGTGATTCTGGGAGG - Intronic
1196769799 X:119282107-119282129 AAGAAAATGGAGAGGGAGGCCGG - Intergenic
1198210595 X:134512310-134512332 AAGGCCATGGAGATGAGGGCAGG + Intronic
1198305289 X:135376076-135376098 AAGAACATGAAGATGATCACTGG + Intergenic
1200307555 X:155043234-155043256 AAAAACATGCAAATCTTGGCTGG - Intronic
1200596542 Y:5147902-5147924 GCTAAAATGGAGATGTTGGCAGG - Intronic
1201192213 Y:11454266-11454288 ACTAATATGAAGATGTTGGCAGG - Intergenic