ID: 1142886603

View in Genome Browser
Species Human (GRCh38)
Location 17:2916621-2916643
Sequence CTTCACTTGCATAATAGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142886598_1142886603 -7 Left 1142886598 17:2916605-2916627 CCGTGACCTCCAGTCTCTTCACT 0: 1
1: 0
2: 2
3: 44
4: 418
Right 1142886603 17:2916621-2916643 CTTCACTTGCATAATAGGGACGG 0: 1
1: 0
2: 0
3: 7
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142886603 Original CRISPR CTTCACTTGCATAATAGGGA CGG Intronic
908117739 1:60956694-60956716 CTTCAGTTGCGTAACAGGGAGGG + Intronic
916967077 1:169958801-169958823 CTTCATTTTCATAATAGCAAAGG + Intronic
918966825 1:191361838-191361860 CTTCAGATGCAAAATAGGTACGG - Intergenic
919773649 1:201179185-201179207 ATTCACTGGCATGGTAGGGATGG - Intergenic
920033849 1:203053067-203053089 CTTCATCTGTAAAATAGGGATGG - Intronic
920679158 1:208059572-208059594 CTTCCCTTCCATAACAGTGATGG - Intronic
921091940 1:211851985-211852007 CTTTAATTGCATATTAAGGAAGG - Intergenic
1070684691 10:78471993-78472015 CTTCATTTTTAAAATAGGGAGGG - Intergenic
1070751932 10:78969011-78969033 CTTCACTTGCAACTTAGGGTGGG + Intergenic
1072745138 10:97934507-97934529 CTGCAGTTGCATAAACGGGAGGG - Intronic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1076346338 10:129781255-129781277 CCTCACCTGCAGAACAGGGATGG + Intergenic
1085939317 11:81189636-81189658 CTTCACTTGAACAACAGGCATGG - Intergenic
1086315002 11:85581740-85581762 GTTCACTTTAATAAAAGGGAAGG + Intronic
1086387985 11:86329074-86329096 CTTTACTTGGTTAATAGGAAAGG - Intronic
1086595008 11:88560156-88560178 GTTCTTTTGCATAATAGGAAAGG - Intronic
1088663955 11:112075239-112075261 CTTCATCTACAAAATAGGGATGG + Intronic
1095589216 12:43885107-43885129 CCTCACTTTCATAAATGGGATGG - Intronic
1096506798 12:52098785-52098807 CTTCCCTTGGATATTAGGAAGGG + Intergenic
1096602970 12:52743299-52743321 CTTCTCTTGAATAATAAGGAAGG + Intergenic
1098491107 12:71079927-71079949 CTTCATTTGTAAAATAGAGATGG + Intronic
1101014797 12:100489039-100489061 CTTCACTTTCATTTTGGGGAAGG - Intronic
1102782110 12:115574283-115574305 CTTCATCTGCATAACAGGGCTGG - Intergenic
1104278782 12:127354680-127354702 CTTCTGTTGGATCATAGGGACGG + Intergenic
1111561324 13:89952048-89952070 CTTCTCATGCACAATAGCGATGG - Intergenic
1114377719 14:22166506-22166528 CATGTCTTGCATAATGGGGAGGG + Intergenic
1115790035 14:36868201-36868223 ATTCACTTGTATAAATGGGAAGG - Intronic
1120291609 14:82580371-82580393 CTTGACTTAAATAATAGGCAAGG + Intergenic
1121563137 14:94888844-94888866 CCTCACTTGCAGAATAGGCCGGG - Intergenic
1122047470 14:99034341-99034363 GTTCACTTCCATAAAAGAGATGG - Intergenic
1127631935 15:60835627-60835649 CTTCACCTGTAAAATAGAGATGG - Intronic
1130123903 15:81076131-81076153 CTTCAATTGCAAAATTAGGAAGG - Intronic
1130423020 15:83767158-83767180 GTTCACCTGCAAAATGGGGATGG + Intronic
1134233032 16:12443842-12443864 CTTCACTTGCAAAAAGGGTATGG + Intronic
1136700813 16:32139101-32139123 CTTGATTAGCATTATAGGGATGG + Intergenic
1136766844 16:32788358-32788380 CTTGATTAGCATTATAGGGATGG - Intergenic
1136801251 16:33082020-33082042 CTTGATTAGCATTATAGGGATGG + Intergenic
1137823072 16:51464062-51464084 TTTCACTTGTAAAATGGGGAGGG + Intergenic
1141380766 16:83574607-83574629 CCTCATTTGCATCACAGGGATGG + Intronic
1203069239 16_KI270728v1_random:1050610-1050632 CTTGATTAGCATTATAGGGATGG - Intergenic
1142886603 17:2916621-2916643 CTTCACTTGCATAATAGGGACGG + Intronic
1144908881 17:18661840-18661862 CCTCACATGCATATTATGGATGG + Exonic
1146455877 17:33009350-33009372 GCTCTCTGGCATAATAGGGAAGG - Intergenic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1153141500 18:1977456-1977478 CATCACTTACATAATAGTTAAGG + Intergenic
1155546141 18:26917978-26918000 CTTCACTTGGGAAAGAGGGAAGG - Intronic
1156381975 18:36571010-36571032 CTTCACTAGTGCAATAGGGATGG + Intronic
1158868446 18:61660834-61660856 CATCACTTCCATGAAAGGGAAGG - Intergenic
1159299469 18:66544050-66544072 CTTCAAATACATAATATGGAAGG + Exonic
1164853618 19:31503919-31503941 CTTATTTTGCATAATAGAGATGG + Intergenic
1165100241 19:33434857-33434879 CTTCACTCCCAGAACAGGGAGGG - Intronic
1165822663 19:38686440-38686462 CTTCACCTGGAGAACAGGGAGGG - Intronic
926003225 2:9351214-9351236 CTTCACTTGAAAAAGAGAGAAGG + Intronic
927344256 2:22018924-22018946 CTTCATCTGCAAAATAAGGATGG + Intergenic
928942753 2:36742954-36742976 CTTTGCTTTCATTATAGGGAGGG + Intronic
932101591 2:68905923-68905945 GTTCAATAGCATATTAGGGAGGG + Intergenic
932160972 2:69459216-69459238 CTTCTAGTTCATAATAGGGAAGG + Intronic
933859439 2:86450139-86450161 GTTCACTTGACAAATAGGGATGG + Intronic
935527173 2:104184354-104184376 CTTCATTTGGATATTAAGGATGG + Intergenic
937642141 2:124225470-124225492 CTTCAATCACATAAGAGGGAGGG - Intronic
938314563 2:130317009-130317031 CTTCTCTAGCATAACAGAGAGGG - Intergenic
939186471 2:138866839-138866861 CTTGAGTTGCATAATAGAGGAGG - Intergenic
942268388 2:174249666-174249688 CCTCACTTGTAAAATGGGGATGG - Intergenic
942356592 2:175119808-175119830 CTTAACTTACATTAAAGGGAGGG + Intronic
945814366 2:214585902-214585924 TTTCACTTGCAGAAAATGGAAGG + Intergenic
946705823 2:222457912-222457934 CTTCTCTCGCTTCATAGGGAAGG + Intronic
947394235 2:229671708-229671730 TTTCACTTGCAGGAAAGGGACGG + Intronic
948639852 2:239368727-239368749 CCTCACCTGCAGAACAGGGAGGG - Intronic
1170303907 20:14917026-14917048 CTTCCCTTCCTTAATAGGAATGG - Intronic
1170357660 20:15509775-15509797 CTTCATCTGTAAAATAGGGAGGG + Intronic
1182509051 22:30806125-30806147 CTTCATTTGTATAATAAGGATGG - Intronic
951149385 3:19269805-19269827 CTTCACTTGAAAAATAGGGTTGG - Intronic
953200609 3:40775254-40775276 CTTCACATCAATCATAGGGATGG - Intergenic
953267527 3:41406770-41406792 TTTCCCTGGCATAACAGGGAAGG + Intronic
953393765 3:42550063-42550085 GTTCATTAGCATATTAGGGAAGG + Intronic
960426015 3:117508770-117508792 ATTAGATTGCATAATAGGGAAGG + Intergenic
961515464 3:127430684-127430706 AGTCCCTTGCATAATAGGGTGGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963268908 3:143266501-143266523 ATTCATTTGCATAATAGAGAGGG + Exonic
963718773 3:148835587-148835609 GGACACTTGCATAAGAGGGAAGG + Intronic
971003590 4:22349960-22349982 CCTCACCTGGATAATAGAGATGG - Intronic
973693021 4:53459433-53459455 CTACACCTGCAGAATAGGCATGG + Exonic
978049145 4:104173915-104173937 CTTAACTTGCATAATACCAATGG + Intergenic
979036910 4:115732266-115732288 CTTGAGTTGCATAATAAGTATGG - Intergenic
987807386 5:22786638-22786660 CTTCATTTGTGTAATGGGGAAGG + Intronic
988726309 5:33929905-33929927 CTTCACTTGCAGAATGGGCTCGG + Intergenic
989496830 5:42118590-42118612 CCTCACTTGCAAAATAAAGAAGG - Intergenic
991600165 5:68343998-68344020 TTTGACCTCCATAATAGGGAAGG - Intergenic
995420452 5:111961087-111961109 CTTCACTTGCAAAGTGGGAAGGG - Intronic
998466272 5:142346831-142346853 ATTCACTTGCTTAGTGGGGAGGG - Intergenic
1013183628 6:107738680-107738702 CTTCCCTTGAAGAAGAGGGAGGG - Intronic
1013350843 6:109304307-109304329 CTTCACTTGCTGGAGAGGGAAGG + Intergenic
1018163293 6:161069253-161069275 CTTGACTTTCATGATAGAGACGG - Intronic
1021407612 7:20291254-20291276 CTACAGTTGTATAATGGGGATGG - Intergenic
1023988626 7:45113715-45113737 CTGGAATTGGATAATAGGGATGG + Intergenic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1024404848 7:48966842-48966864 CTGCACTTGCGAAATATGGATGG + Intergenic
1028706497 7:93854294-93854316 CATCACTGGTATACTAGGGAGGG + Intronic
1031410640 7:121436922-121436944 CTTCATTTGCATATTAGGGTGGG - Intergenic
1035441082 7:158900667-158900689 ATTCACATGTATAATGGGGATGG - Intronic
1036974203 8:13392051-13392073 CTTCATTTTCATAATGGGTAAGG - Intronic
1037828275 8:22173050-22173072 ATTTACTTGCATATTATGGAAGG + Intronic
1039458092 8:37721158-37721180 CTACACTTTCAGAATGGGGAGGG - Intergenic
1040432130 8:47353440-47353462 CTAAGCTTGCATATTAGGGAGGG - Intronic
1040487491 8:47887205-47887227 CTTCACATGGATGATTGGGAGGG - Intronic
1040639075 8:49310692-49310714 CTTCCCTTGAATAAGAGTGAAGG - Intergenic
1041039448 8:53832103-53832125 CTTTACAGGCATAGTAGGGAAGG + Intronic
1041450223 8:57997887-57997909 CTTCACTTGTATTATAGAAAGGG - Intronic
1044321808 8:90810668-90810690 CTTCACTTGCGAACTAAGGAAGG + Intronic
1044575520 8:93764811-93764833 CATCACTTGCAAAATAGAGCAGG - Intronic
1044629687 8:94266354-94266376 CATCACATGCATAAGAGGAAAGG - Intergenic
1047176168 8:122542521-122542543 CTGCCTTTGCATAATTGGGAAGG - Intergenic
1050611517 9:7358878-7358900 CTTCCCTTGCATAATTGGTAGGG + Intergenic
1050847942 9:10247062-10247084 CTTCACATGCATAAAATGTAAGG + Intronic
1056489171 9:87087974-87087996 CTTCTCTTGCATAAGAGTTAGGG - Intergenic
1058761172 9:108133911-108133933 CTTCACTTACATAACAAAGATGG - Intergenic
1185635509 X:1549020-1549042 CTTCACTTGTCTCAGAGGGATGG - Intergenic
1188006260 X:25017546-25017568 CTGCACTTGGATGATAGGGCGGG + Intergenic
1195940594 X:110164469-110164491 CTTGACTTGGAGATTAGGGAGGG + Intronic
1196072492 X:111541941-111541963 ATAGACTTGAATAATAGGGATGG - Intergenic
1198581059 X:138064695-138064717 CTTCACATGCATAGAAGAGAAGG - Intergenic
1200980329 Y:9258169-9258191 CTTCACTTGAAAAAAAGTGAAGG + Intergenic
1201639821 Y:16166932-16166954 CTTCCCTTGTAGAATAGAGAAGG - Intergenic
1201662992 Y:16418393-16418415 CTTCCCTTGTAGAATAGAGAAGG + Intergenic