ID: 1142888010

View in Genome Browser
Species Human (GRCh38)
Location 17:2925223-2925245
Sequence CTTGCATCACTTTTGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142888010 Original CRISPR CTTGCATCACTTTTGGAGGA AGG (reversed) Intronic
901532114 1:9860131-9860153 CCCTCATCAATTTTGGAGGAAGG - Intronic
904152913 1:28457673-28457695 CAAGTAACACTTTTGGAGGAGGG - Intronic
904734211 1:32617913-32617935 CTTCCCTTACTTTAGGAGGAAGG + Intronic
905212069 1:36381203-36381225 CCTGCATCTGCTTTGGAGGATGG - Intronic
905322608 1:37128605-37128627 CTCGCATCTCTTTTGGATGAAGG + Intergenic
905437785 1:37970050-37970072 ATCCCATCACTTTTGGAGGCTGG + Intronic
905746571 1:40423345-40423367 TGTGCGTCACTCTTGGAGGAGGG + Intergenic
906707910 1:47908476-47908498 CTTGCATCAACTCTGGAGGTGGG - Intronic
907469361 1:54663053-54663075 CTTTCATCACTTGAGTAGGATGG + Intronic
912271162 1:108210116-108210138 TTTGCATTTATTTTGGAGGATGG - Intergenic
912794884 1:112686983-112687005 CTGGCATCAGGATTGGAGGATGG - Intronic
913659323 1:120992620-120992642 CTTGCAACACTTTCTCAGGATGG + Intergenic
914010686 1:143775744-143775766 CTTGCAACACTTTCTGAGGATGG + Intergenic
914167140 1:145185371-145185393 CTTGCAACACTTTCTCAGGATGG - Intergenic
914649309 1:149684401-149684423 CTTGCAACACTTTCTCAGGATGG + Intergenic
914862370 1:151397394-151397416 ATTCCATCACTTTGGGAGGCTGG + Intergenic
917527845 1:175805030-175805052 CCTGTAGCACTTTTGGAGGCAGG + Intergenic
917893884 1:179467111-179467133 CTTTCATGGATTTTGGAGGATGG - Intronic
922315640 1:224439512-224439534 CTTGCAGCACTTTTGCAGTATGG + Intronic
923036641 1:230289093-230289115 CTGGCATCATTTCTGGAGCATGG - Intergenic
924417175 1:243868908-243868930 CTTCCATCACTCTAGGAAGAGGG - Intergenic
1062800005 10:371813-371835 CTTGTCTCACTTCTGGAGGCTGG - Intronic
1063119281 10:3093247-3093269 CTTTCAACACTGTTGGGGGAAGG - Intronic
1067238783 10:44473059-44473081 CTTTCCTCCCTTTTGGAGGTAGG + Intergenic
1067688572 10:48484114-48484136 CCAGCATCACTTATTGAGGAGGG + Intronic
1067824188 10:49557989-49558011 CTGTCATCACTTTTGTTGGAAGG - Intergenic
1068818816 10:61349358-61349380 CTTGGAACACATTTGGAAGATGG + Intergenic
1071355354 10:84788315-84788337 CATGCATCACCTTCAGAGGAAGG + Intergenic
1074163452 10:110853908-110853930 CTGGCACAACTTTGGGAGGAAGG - Intergenic
1075239856 10:120768420-120768442 TTTGCATAACTTCTGGAGAAGGG + Intergenic
1076812136 10:132892410-132892432 CTTGCGTTACTTTAGGAGAAAGG - Exonic
1077795277 11:5485118-5485140 CTTCCATCACCTTTGGTGGAGGG - Intronic
1077968169 11:7158240-7158262 CTTGCATTATGTTTTGAGGAGGG - Intergenic
1078511127 11:11985053-11985075 TTTGCTTCACTTTTGTGGGATGG + Intronic
1078784132 11:14471377-14471399 GTTGCATCACTTCTGGAAGTTGG - Intronic
1079458884 11:20662239-20662261 CTCCCATCCCTTGTGGAGGAAGG + Intergenic
1080993119 11:37565518-37565540 ATTGCAACACTTTGGGAGGCCGG + Intergenic
1084300007 11:68242899-68242921 ATTCCAGCACTTTTGGAGGCAGG + Intergenic
1085700996 11:78746225-78746247 CTTCCATCACTCCTTGAGGAGGG + Intronic
1087988608 11:104717733-104717755 ATTGTCTCACTTTTGGAGGCTGG + Intergenic
1088480029 11:110287596-110287618 TTTGCTTCACTTTGGGATGACGG - Intronic
1088619488 11:111667199-111667221 CTTCCAGCACTTTGGGAGGCCGG - Intronic
1089465725 11:118684776-118684798 TCTCCATCACTTTTGAAGGATGG + Intergenic
1090140279 11:124250935-124250957 TTGGTATCACTTTTGGAAGATGG - Intergenic
1090922532 11:131218946-131218968 GTTGAATCACGTCTGGAGGATGG + Intergenic
1092252812 12:6910329-6910351 CTCCCAGCACTTTAGGAGGAAGG + Intronic
1097126226 12:56777767-56777789 CTTCCAGCACTTTGGGAGGCCGG + Intronic
1098520621 12:71431690-71431712 GTTGCCTGACTTTTGGAGTAGGG - Intronic
1101370866 12:104129026-104129048 CTTATATCACTTATGGAAGATGG - Intronic
1101566087 12:105906948-105906970 CCTTCATTTCTTTTGGAGGATGG + Intergenic
1101621510 12:106393305-106393327 CTTTCGTCAGGTTTGGAGGAAGG + Intronic
1102880427 12:116480953-116480975 CTTGAATCACTTGTGGTGGGTGG + Intergenic
1103250673 12:119497277-119497299 ATTGCATACCTTGTGGAGGAGGG - Intronic
1109246402 13:59959250-59959272 CTTGCATTCCTTTTATAGGAAGG - Intronic
1110327017 13:74228492-74228514 GTTGCATCACTTTGTGAGTAAGG + Intergenic
1110602112 13:77387086-77387108 CATGGGTCACTTTTGGAGGAAGG - Intergenic
1112877695 13:104065319-104065341 TTTGCATCATTTATGGTGGATGG - Intergenic
1113713077 13:112483674-112483696 CATGCATCATTTATGGATGAAGG + Intergenic
1115335722 14:32242802-32242824 CTTGCTTTACTTTTGCAAGAAGG + Intergenic
1116353460 14:43896678-43896700 TTTACATTATTTTTGGAGGAAGG - Intergenic
1117362678 14:54992660-54992682 ATTGCAGCACTTTGGGAGGCTGG + Intronic
1119054968 14:71409803-71409825 CTTGCAACATTTTTGTAGGTTGG + Intronic
1122226664 14:100284705-100284727 CTGGCATGACATCTGGAGGAAGG + Intergenic
1128051083 15:64665448-64665470 CTTAAATCACTTTTTGAGGAAGG - Intronic
1129035500 15:72646295-72646317 CCTGCCTCACATTTGAAGGATGG + Intergenic
1129214384 15:74090921-74090943 CCTGCCTCACATTTGAAGGATGG - Intergenic
1129391027 15:75221008-75221030 CCTGCCTCACATTTGAAGGATGG + Intergenic
1133552481 16:6870544-6870566 CTTGTATAACTTTTGCAGGCTGG + Intronic
1134386100 16:13773989-13774011 ATTGCAGCACTTTGGGAGGTGGG + Intergenic
1138623134 16:58227544-58227566 CTTGCATGACTTTTTGTGGGGGG + Intergenic
1141076676 16:81012178-81012200 CTTACATCTCTTTTGGAGTAAGG - Intronic
1142888010 17:2925223-2925245 CTTGCATCACTTTTGGAGGAAGG - Intronic
1144154418 17:12485310-12485332 TTGGCAGCACGTTTGGAGGATGG - Intergenic
1145068464 17:19781498-19781520 ATTCCAGCACTTTGGGAGGATGG - Intronic
1145883940 17:28370036-28370058 CTTGCATGACTCTATGAGGAAGG + Exonic
1146656624 17:34638533-34638555 CTTGCCTCACTCTTGGGGCAGGG - Exonic
1147135101 17:38429573-38429595 CTTGCAACTCTTTTGGAGACTGG + Intronic
1147235498 17:39054567-39054589 ATTCCAGCACTTTGGGAGGAGGG + Intergenic
1147282009 17:39369884-39369906 ATCCCAGCACTTTTGGAGGAGGG - Intronic
1147936227 17:44012799-44012821 GTGGCAACACTGTTGGAGGAAGG + Intronic
1148005493 17:44425227-44425249 CTTGCTTGACTTTTAGAGCAGGG + Intronic
1148560733 17:48604424-48604446 TTTGCATCGCTTTTGTAGGGTGG - Intronic
1151213540 17:72562083-72562105 CCTGCAGCTGTTTTGGAGGAAGG + Intergenic
1153270805 18:3319253-3319275 TTTGCTTCCCTTTTGGAGTAGGG + Intergenic
1153459667 18:5319534-5319556 CTTGCATCAGTTTTCCAGAATGG + Intergenic
1153780003 18:8486065-8486087 CTTTTAGCACTTCTGGAGGAAGG + Intergenic
1154993386 18:21617025-21617047 CTTGGATTACTTTTGGAAAATGG + Intronic
1156353441 18:36321435-36321457 CTTGCATGACTTCTGGATAATGG + Intronic
1156905428 18:42347033-42347055 CTTGAATCCCTTTTGAAGGAAGG - Intergenic
1157076410 18:44472409-44472431 CTTGGGACACCTTTGGAGGAAGG - Intergenic
1157249965 18:46086359-46086381 TTTGCATCACTTTGGCAGTAAGG - Intronic
1159021069 18:63143595-63143617 CTTGCATCCCTTCTGCAGGCAGG - Intronic
1160591714 18:79948591-79948613 ATTCCAGCACTTTTGGAGGCCGG - Intronic
1161156976 19:2737099-2737121 TCTGCAACACCTTTGGAGGAGGG - Exonic
1162277068 19:9664319-9664341 ATTCCAGCACTTTTGGAGGCTGG - Intronic
1165691353 19:37866152-37866174 CTTGCAGCACTTTGGGAGGCCGG - Intergenic
1166624752 19:44340688-44340710 CTTGCAGCCCTTTTGGTGAATGG - Intronic
1168522923 19:57066896-57066918 ATTGCAGCACTTTGGGAGGCCGG + Intergenic
930627389 2:53713084-53713106 ATCCCATCACTTTTGGAGGCTGG + Intronic
931396741 2:61894396-61894418 CTTGCCTCACTTTTTTAGGCTGG - Intronic
934844340 2:97652746-97652768 ATTCCAGCACTTTTGGAGGCTGG + Intergenic
934912431 2:98271908-98271930 CTTGCAGCAGTGTTGGAGGTGGG + Intronic
938644390 2:133316107-133316129 CTTGGGACACTTTTGGAGAATGG + Intronic
939087912 2:137743681-137743703 CTGGCATGACTTTAGGAGGCAGG + Intergenic
940440799 2:153713887-153713909 ATTGTATCACTTTGGGAGGATGG - Intergenic
940867877 2:158835478-158835500 CTTGCCTCACTCTCAGAGGATGG - Intronic
943589396 2:189779222-189779244 ATCCCAGCACTTTTGGAGGATGG + Intronic
947576366 2:231278159-231278181 TTTGCATCACCTTTTGAGGTAGG + Intronic
1178757478 21:35365347-35365369 CTTGAATCATTTTTTTAGGAAGG - Intronic
1179654971 21:42839285-42839307 CTTCCATCAGATTTGGGGGAGGG - Intergenic
949095050 3:75936-75958 CTTGCATCATTTGTGAAGGTGGG - Intergenic
951175939 3:19600124-19600146 ATTGCCTGACTTTTGGATGAAGG - Intergenic
952373307 3:32743902-32743924 CTTGCCTCACTTTATGATGACGG - Intronic
952524845 3:34199230-34199252 CCTGCAGCACGTCTGGAGGATGG + Intergenic
952961869 3:38597342-38597364 CTTGCATCAGTGTTGTTGGATGG - Intronic
954189007 3:48942901-48942923 ATTCCAGCACTTTGGGAGGATGG - Intronic
954290142 3:49645378-49645400 CTTGCATCTCTGGTGGTGGATGG - Intronic
955747216 3:62152111-62152133 ATTGCAGCACTTTGGGAGGCTGG + Intronic
956984723 3:74685464-74685486 CTTTCATCACATTTGGAGTCAGG + Intergenic
957534184 3:81480071-81480093 TTTGCATTATTTTTGGAGAAAGG - Intergenic
964285264 3:155110697-155110719 CATGCATTACTTTTGCAGTAAGG - Intronic
972812151 4:42602017-42602039 CTTGCAGCACTTTTGGTATATGG + Intronic
974167617 4:58224128-58224150 CTTGCTTCAGTTTAGGAGCAGGG + Intergenic
974227837 4:59070656-59070678 CTTCCATCACTATTAGAGCAAGG - Intergenic
975592040 4:76010633-76010655 ATTGCAGCACTTTGGGAGGGCGG - Intergenic
984946544 4:184973128-184973150 CCTGAATGACTTTTGGAGGAGGG - Intergenic
986283892 5:6345977-6345999 CTTGCGCCACTTTTGGAGCATGG - Intergenic
986341164 5:6790621-6790643 CTCGCATCCCTTGTGGAGGATGG + Intergenic
986912994 5:12580207-12580229 CTTGCAACACTATTTGAGGATGG + Intergenic
986998384 5:13633426-13633448 CTTCTATCACTTTTGGTTGAGGG - Intergenic
989426972 5:41307197-41307219 TTTGCTTCATTTCTGGAGGATGG - Exonic
991091943 5:62702046-62702068 CTTGCATGTCTTCTGAAGGAAGG + Intergenic
992340086 5:75814531-75814553 GTTGCAGCTCTTTTGGGGGATGG + Intergenic
993347875 5:86807685-86807707 CTTTCATTCCCTTTGGAGGAAGG - Intergenic
995353661 5:111212467-111212489 TTTGCATCAGTTTTGGTGAATGG + Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
996138135 5:119870307-119870329 TTTGCTTGACTTTTGGATGATGG + Intergenic
996721572 5:126635677-126635699 CTTCCATCATTTTTGGAGAGGGG + Intronic
996806995 5:127467178-127467200 CAGTCATCACTTCTGGAGGAAGG + Intergenic
997463814 5:134073151-134073173 CTGGCATCCCTTTGGGAGGCAGG - Intergenic
998082429 5:139287912-139287934 CTTGCATTAATTTTGGTGGCCGG + Intronic
1003525542 6:6893790-6893812 GTTGAATCACTTTTGAAGGAAGG - Intergenic
1005210413 6:23454142-23454164 CTTTCATTATTTGTGGAGGAGGG - Intergenic
1006320869 6:33318688-33318710 CTGGGATAACATTTGGAGGAAGG - Exonic
1008457111 6:51723998-51724020 ATTGCATTTCTTTTGGAAGAAGG - Intronic
1009303361 6:62055780-62055802 GTTGCATCACATTTGGAAGACGG + Intronic
1009506245 6:64483956-64483978 TTTGCAACACTTTTGTAGGTGGG + Intronic
1010249983 6:73697166-73697188 CATGCATCACTACTAGAGGAAGG - Intronic
1012695950 6:102383843-102383865 CCTGTCTCACTTATGGAGGATGG + Intergenic
1015098987 6:129451762-129451784 CTTGCATGACCCTTGGAGAAGGG + Intronic
1018791105 6:167148406-167148428 CTTGTATGACTTTTGGAAGCAGG + Intronic
1021910325 7:25379330-25379352 CTGGCAACACTTTTGAAGCAAGG + Intergenic
1021986161 7:26100473-26100495 CCTGCATAACTTTTGGTGGCGGG - Intergenic
1024994981 7:55267170-55267192 TTCGCAGCAGTTTTGGAGGACGG + Intergenic
1025908733 7:65810469-65810491 ATTCCAGCACTTTGGGAGGAGGG + Intergenic
1027407560 7:77877929-77877951 TTTGAATCACTGTTGGGGGAAGG + Intronic
1028833584 7:95350432-95350454 CTTGCTTTACTTTTGCAAGAAGG - Intergenic
1030011651 7:105174653-105174675 CTTTTATCAGTTTTGGGGGAAGG - Intronic
1030077182 7:105746846-105746868 CTTGCTTATCTTTGGGAGGATGG + Intronic
1032705537 7:134418533-134418555 CTTGAATCAATTTTGGAGAGAGG - Intergenic
1033357047 7:140608422-140608444 ATTCCAGCACTTTTGGAGGCCGG + Intronic
1037618022 8:20537452-20537474 CCTGCAACACACTTGGAGGAAGG + Intergenic
1041605983 8:59782896-59782918 GTTTCATTACTTTGGGAGGAGGG - Intergenic
1043768122 8:84163209-84163231 CTTTCCTCACTTTTGGAAGGTGG + Intergenic
1045054358 8:98356501-98356523 CTTCCATGAGTTTTGCAGGAAGG - Intergenic
1046099774 8:109601201-109601223 CTTGTATGTCTTTGGGAGGAAGG - Intronic
1046168045 8:110465620-110465642 ATTGCATGATTATTGGAGGATGG + Intergenic
1048927004 8:139280454-139280476 ATTGCCTCACTTCTGGAGGCTGG + Intergenic
1050818069 9:9840259-9840281 CATGCAGCACTTTAGGAGGTGGG - Intronic
1051685285 9:19652172-19652194 GTTTCATCAGTTTTGGAGGTAGG + Intronic
1052951689 9:34218679-34218701 ATTGCAGCACTTTGGGAGGCTGG + Intronic
1055424461 9:76179942-76179964 CTTCTCTCACGTTTGGAGGACGG + Intronic
1056923507 9:90812870-90812892 TCTGCAGAACTTTTGGAGGAAGG + Intronic
1058139131 9:101339494-101339516 TGTGCAGAACTTTTGGAGGAGGG + Intergenic
1058411702 9:104740373-104740395 CTCCCATCACTTTTGGGTGATGG + Intergenic
1058711136 9:107680310-107680332 CTTGTATGACCTTTGGAAGATGG + Intergenic
1058795316 9:108492200-108492222 ATTCCATCACTTTGGGAGGGAGG - Intergenic
1061141591 9:128770915-128770937 TTTCCAGCACTTTTGGAGGCTGG + Intronic
1062166458 9:135110109-135110131 ATTGCCTCAGTGTTGGAGGAGGG + Intronic
1186439806 X:9576125-9576147 CATGCTACACTTTGGGAGGAGGG - Intronic
1187864883 X:23715015-23715037 CTTGTATCATTTATTGAGGAGGG - Intronic
1192980832 X:76339274-76339296 CATTCATCATTTTTGGTGGAGGG - Intergenic
1199697856 X:150356090-150356112 CTTGCATCACCTTGTGAGAAAGG - Intergenic
1199756160 X:150867155-150867177 ATTCCAGCACTTTGGGAGGATGG + Intronic
1200493156 Y:3852579-3852601 CTTGCATTATTTTTGTAAGAAGG + Intergenic
1201416890 Y:13755842-13755864 CTTACACCATTTTTGGGGGAGGG + Intergenic