ID: 1142888894

View in Genome Browser
Species Human (GRCh38)
Location 17:2930217-2930239
Sequence CCTGGTGAGCCACTGTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 129}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142888894_1142888904 11 Left 1142888894 17:2930217-2930239 CCTTCCTACAGTGGCTCACCAGG 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1142888904 17:2930251-2930273 CCAATACCATCAGTACCACGTGG 0: 1
1: 0
2: 0
3: 4
4: 97
1142888894_1142888905 12 Left 1142888894 17:2930217-2930239 CCTTCCTACAGTGGCTCACCAGG 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1142888905 17:2930252-2930274 CAATACCATCAGTACCACGTGGG 0: 1
1: 0
2: 0
3: 4
4: 105
1142888894_1142888910 26 Left 1142888894 17:2930217-2930239 CCTTCCTACAGTGGCTCACCAGG 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1142888910 17:2930266-2930288 CCACGTGGGAGCCTGTGGCTGGG 0: 1
1: 0
2: 1
3: 30
4: 412
1142888894_1142888907 21 Left 1142888894 17:2930217-2930239 CCTTCCTACAGTGGCTCACCAGG 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1142888907 17:2930261-2930283 CAGTACCACGTGGGAGCCTGTGG 0: 1
1: 0
2: 1
3: 20
4: 183
1142888894_1142888908 25 Left 1142888894 17:2930217-2930239 CCTTCCTACAGTGGCTCACCAGG 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1142888908 17:2930265-2930287 ACCACGTGGGAGCCTGTGGCTGG 0: 1
1: 0
2: 4
3: 176
4: 6594
1142888894_1142888911 27 Left 1142888894 17:2930217-2930239 CCTTCCTACAGTGGCTCACCAGG 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1142888911 17:2930267-2930289 CACGTGGGAGCCTGTGGCTGGGG 0: 1
1: 0
2: 0
3: 45
4: 515

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142888894 Original CRISPR CCTGGTGAGCCACTGTAGGA AGG (reversed) Intronic