ID: 1142888896

View in Genome Browser
Species Human (GRCh38)
Location 17:2930221-2930243
Sequence GGGGCCTGGTGAGCCACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 278}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142888896_1142888908 21 Left 1142888896 17:2930221-2930243 CCTACAGTGGCTCACCAGGCCCC 0: 1
1: 0
2: 2
3: 19
4: 278
Right 1142888908 17:2930265-2930287 ACCACGTGGGAGCCTGTGGCTGG 0: 1
1: 0
2: 4
3: 176
4: 6594
1142888896_1142888910 22 Left 1142888896 17:2930221-2930243 CCTACAGTGGCTCACCAGGCCCC 0: 1
1: 0
2: 2
3: 19
4: 278
Right 1142888910 17:2930266-2930288 CCACGTGGGAGCCTGTGGCTGGG 0: 1
1: 0
2: 1
3: 30
4: 412
1142888896_1142888905 8 Left 1142888896 17:2930221-2930243 CCTACAGTGGCTCACCAGGCCCC 0: 1
1: 0
2: 2
3: 19
4: 278
Right 1142888905 17:2930252-2930274 CAATACCATCAGTACCACGTGGG 0: 1
1: 0
2: 0
3: 4
4: 105
1142888896_1142888911 23 Left 1142888896 17:2930221-2930243 CCTACAGTGGCTCACCAGGCCCC 0: 1
1: 0
2: 2
3: 19
4: 278
Right 1142888911 17:2930267-2930289 CACGTGGGAGCCTGTGGCTGGGG 0: 1
1: 0
2: 0
3: 45
4: 515
1142888896_1142888914 29 Left 1142888896 17:2930221-2930243 CCTACAGTGGCTCACCAGGCCCC 0: 1
1: 0
2: 2
3: 19
4: 278
Right 1142888914 17:2930273-2930295 GGAGCCTGTGGCTGGGGCTGGGG 0: 1
1: 1
2: 17
3: 243
4: 1714
1142888896_1142888913 28 Left 1142888896 17:2930221-2930243 CCTACAGTGGCTCACCAGGCCCC 0: 1
1: 0
2: 2
3: 19
4: 278
Right 1142888913 17:2930272-2930294 GGGAGCCTGTGGCTGGGGCTGGG 0: 1
1: 0
2: 11
3: 121
4: 1118
1142888896_1142888904 7 Left 1142888896 17:2930221-2930243 CCTACAGTGGCTCACCAGGCCCC 0: 1
1: 0
2: 2
3: 19
4: 278
Right 1142888904 17:2930251-2930273 CCAATACCATCAGTACCACGTGG 0: 1
1: 0
2: 0
3: 4
4: 97
1142888896_1142888915 30 Left 1142888896 17:2930221-2930243 CCTACAGTGGCTCACCAGGCCCC 0: 1
1: 0
2: 2
3: 19
4: 278
Right 1142888915 17:2930274-2930296 GAGCCTGTGGCTGGGGCTGGGGG 0: 1
1: 0
2: 19
3: 214
4: 1438
1142888896_1142888912 27 Left 1142888896 17:2930221-2930243 CCTACAGTGGCTCACCAGGCCCC 0: 1
1: 0
2: 2
3: 19
4: 278
Right 1142888912 17:2930271-2930293 TGGGAGCCTGTGGCTGGGGCTGG 0: 1
1: 0
2: 13
3: 201
4: 1232
1142888896_1142888907 17 Left 1142888896 17:2930221-2930243 CCTACAGTGGCTCACCAGGCCCC 0: 1
1: 0
2: 2
3: 19
4: 278
Right 1142888907 17:2930261-2930283 CAGTACCACGTGGGAGCCTGTGG 0: 1
1: 0
2: 1
3: 20
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142888896 Original CRISPR GGGGCCTGGTGAGCCACTGT AGG (reversed) Intronic