ID: 1142888902

View in Genome Browser
Species Human (GRCh38)
Location 17:2930243-2930265
Sequence TACTGATGGTATTGGCCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 140}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142888902_1142888915 8 Left 1142888902 17:2930243-2930265 CCTTGTGGCCAATACCATCAGTA 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1142888915 17:2930274-2930296 GAGCCTGTGGCTGGGGCTGGGGG 0: 1
1: 0
2: 19
3: 214
4: 1438
1142888902_1142888921 19 Left 1142888902 17:2930243-2930265 CCTTGTGGCCAATACCATCAGTA 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1142888921 17:2930285-2930307 TGGGGCTGGGGGTCTGGGGAGGG 0: 1
1: 5
2: 40
3: 593
4: 4994
1142888902_1142888911 1 Left 1142888902 17:2930243-2930265 CCTTGTGGCCAATACCATCAGTA 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1142888911 17:2930267-2930289 CACGTGGGAGCCTGTGGCTGGGG 0: 1
1: 0
2: 0
3: 45
4: 515
1142888902_1142888907 -5 Left 1142888902 17:2930243-2930265 CCTTGTGGCCAATACCATCAGTA 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1142888907 17:2930261-2930283 CAGTACCACGTGGGAGCCTGTGG 0: 1
1: 0
2: 1
3: 20
4: 183
1142888902_1142888913 6 Left 1142888902 17:2930243-2930265 CCTTGTGGCCAATACCATCAGTA 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1142888913 17:2930272-2930294 GGGAGCCTGTGGCTGGGGCTGGG 0: 1
1: 0
2: 11
3: 121
4: 1118
1142888902_1142888922 20 Left 1142888902 17:2930243-2930265 CCTTGTGGCCAATACCATCAGTA 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1142888922 17:2930286-2930308 GGGGCTGGGGGTCTGGGGAGGGG 0: 1
1: 5
2: 46
3: 498
4: 3379
1142888902_1142888914 7 Left 1142888902 17:2930243-2930265 CCTTGTGGCCAATACCATCAGTA 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1142888914 17:2930273-2930295 GGAGCCTGTGGCTGGGGCTGGGG 0: 1
1: 1
2: 17
3: 243
4: 1714
1142888902_1142888910 0 Left 1142888902 17:2930243-2930265 CCTTGTGGCCAATACCATCAGTA 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1142888910 17:2930266-2930288 CCACGTGGGAGCCTGTGGCTGGG 0: 1
1: 0
2: 1
3: 30
4: 412
1142888902_1142888912 5 Left 1142888902 17:2930243-2930265 CCTTGTGGCCAATACCATCAGTA 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1142888912 17:2930271-2930293 TGGGAGCCTGTGGCTGGGGCTGG 0: 1
1: 0
2: 13
3: 201
4: 1232
1142888902_1142888918 14 Left 1142888902 17:2930243-2930265 CCTTGTGGCCAATACCATCAGTA 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1142888918 17:2930280-2930302 GTGGCTGGGGCTGGGGGTCTGGG 0: 1
1: 1
2: 18
3: 159
4: 1470
1142888902_1142888920 18 Left 1142888902 17:2930243-2930265 CCTTGTGGCCAATACCATCAGTA 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1142888920 17:2930284-2930306 CTGGGGCTGGGGGTCTGGGGAGG 0: 1
1: 1
2: 36
3: 283
4: 2304
1142888902_1142888908 -1 Left 1142888902 17:2930243-2930265 CCTTGTGGCCAATACCATCAGTA 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1142888908 17:2930265-2930287 ACCACGTGGGAGCCTGTGGCTGG 0: 1
1: 0
2: 4
3: 176
4: 6594
1142888902_1142888917 13 Left 1142888902 17:2930243-2930265 CCTTGTGGCCAATACCATCAGTA 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1142888917 17:2930279-2930301 TGTGGCTGGGGCTGGGGGTCTGG 0: 1
1: 0
2: 26
3: 431
4: 2031
1142888902_1142888919 15 Left 1142888902 17:2930243-2930265 CCTTGTGGCCAATACCATCAGTA 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1142888919 17:2930281-2930303 TGGCTGGGGCTGGGGGTCTGGGG 0: 1
1: 2
2: 23
3: 264
4: 1820

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142888902 Original CRISPR TACTGATGGTATTGGCCACA AGG (reversed) Intronic