ID: 1142888905

View in Genome Browser
Species Human (GRCh38)
Location 17:2930252-2930274
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 105}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142888891_1142888905 30 Left 1142888891 17:2930199-2930221 CCCAGCTGTGGGTCTGGACCTTC 0: 1
1: 0
2: 1
3: 25
4: 213
Right 1142888905 17:2930252-2930274 CAATACCATCAGTACCACGTGGG 0: 1
1: 0
2: 0
3: 4
4: 105
1142888892_1142888905 29 Left 1142888892 17:2930200-2930222 CCAGCTGTGGGTCTGGACCTTCC 0: 1
1: 0
2: 0
3: 18
4: 207
Right 1142888905 17:2930252-2930274 CAATACCATCAGTACCACGTGGG 0: 1
1: 0
2: 0
3: 4
4: 105
1142888896_1142888905 8 Left 1142888896 17:2930221-2930243 CCTACAGTGGCTCACCAGGCCCC 0: 1
1: 0
2: 2
3: 19
4: 278
Right 1142888905 17:2930252-2930274 CAATACCATCAGTACCACGTGGG 0: 1
1: 0
2: 0
3: 4
4: 105
1142888894_1142888905 12 Left 1142888894 17:2930217-2930239 CCTTCCTACAGTGGCTCACCAGG 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1142888905 17:2930252-2930274 CAATACCATCAGTACCACGTGGG 0: 1
1: 0
2: 0
3: 4
4: 105
1142888898_1142888905 -6 Left 1142888898 17:2930235-2930257 CCAGGCCCCCTTGTGGCCAATAC 0: 1
1: 0
2: 2
3: 3
4: 82
Right 1142888905 17:2930252-2930274 CAATACCATCAGTACCACGTGGG 0: 1
1: 0
2: 0
3: 4
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type