ID: 1142888911

View in Genome Browser
Species Human (GRCh38)
Location 17:2930267-2930289
Sequence CACGTGGGAGCCTGTGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 515}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142888903_1142888911 -7 Left 1142888903 17:2930251-2930273 CCAATACCATCAGTACCACGTGG 0: 1
1: 0
2: 1
3: 8
4: 99
Right 1142888911 17:2930267-2930289 CACGTGGGAGCCTGTGGCTGGGG 0: 1
1: 0
2: 0
3: 45
4: 515
1142888901_1142888911 2 Left 1142888901 17:2930242-2930264 CCCTTGTGGCCAATACCATCAGT 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1142888911 17:2930267-2930289 CACGTGGGAGCCTGTGGCTGGGG 0: 1
1: 0
2: 0
3: 45
4: 515
1142888898_1142888911 9 Left 1142888898 17:2930235-2930257 CCAGGCCCCCTTGTGGCCAATAC 0: 1
1: 0
2: 2
3: 3
4: 82
Right 1142888911 17:2930267-2930289 CACGTGGGAGCCTGTGGCTGGGG 0: 1
1: 0
2: 0
3: 45
4: 515
1142888894_1142888911 27 Left 1142888894 17:2930217-2930239 CCTTCCTACAGTGGCTCACCAGG 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1142888911 17:2930267-2930289 CACGTGGGAGCCTGTGGCTGGGG 0: 1
1: 0
2: 0
3: 45
4: 515
1142888896_1142888911 23 Left 1142888896 17:2930221-2930243 CCTACAGTGGCTCACCAGGCCCC 0: 1
1: 0
2: 2
3: 19
4: 278
Right 1142888911 17:2930267-2930289 CACGTGGGAGCCTGTGGCTGGGG 0: 1
1: 0
2: 0
3: 45
4: 515
1142888900_1142888911 3 Left 1142888900 17:2930241-2930263 CCCCTTGTGGCCAATACCATCAG 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1142888911 17:2930267-2930289 CACGTGGGAGCCTGTGGCTGGGG 0: 1
1: 0
2: 0
3: 45
4: 515
1142888899_1142888911 4 Left 1142888899 17:2930240-2930262 CCCCCTTGTGGCCAATACCATCA 0: 1
1: 0
2: 1
3: 13
4: 123
Right 1142888911 17:2930267-2930289 CACGTGGGAGCCTGTGGCTGGGG 0: 1
1: 0
2: 0
3: 45
4: 515
1142888902_1142888911 1 Left 1142888902 17:2930243-2930265 CCTTGTGGCCAATACCATCAGTA 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1142888911 17:2930267-2930289 CACGTGGGAGCCTGTGGCTGGGG 0: 1
1: 0
2: 0
3: 45
4: 515

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142888911 Original CRISPR CACGTGGGAGCCTGTGGCTG GGG Intronic