ID: 1142889082

View in Genome Browser
Species Human (GRCh38)
Location 17:2931427-2931449
Sequence GCTGAGTGATTCCCCCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142889081_1142889082 2 Left 1142889081 17:2931402-2931424 CCACGTTGGTGTGAATGTATCTG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1142889082 17:2931427-2931449 GCTGAGTGATTCCCCCAGCCAGG 0: 1
1: 0
2: 1
3: 19
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142889082 Original CRISPR GCTGAGTGATTCCCCCAGCC AGG Intronic
900472739 1:2862845-2862867 GCTGAGTGTTTCCAGCTGCCAGG - Intergenic
900636698 1:3669511-3669533 GCAGAGTGACTGCCCCAGCCTGG + Intronic
902439733 1:16421576-16421598 GCTGAGCGCTTCCCCCACCTGGG - Intronic
903181651 1:21608054-21608076 GCTGTGTCAATCCCCCAGTCCGG + Intronic
905134694 1:35789492-35789514 GTTGAGGGCTTCCCCCAGGCAGG + Intergenic
906185389 1:43858601-43858623 GCTGTGTGAGGCTCCCAGCCAGG + Intronic
906745244 1:48216846-48216868 TATGAAGGATTCCCCCAGCCTGG + Intergenic
916619584 1:166481872-166481894 ACTGAGAGAATCCCCCATCCTGG + Intergenic
919726536 1:200888251-200888273 GCTGAGTGAGGCCCCCTGGCTGG + Intergenic
920635147 1:207695027-207695049 AATGAGTGATTCTTCCAGCCAGG + Intronic
921269279 1:213452747-213452769 GCTGTGGGATCCCGCCAGCCTGG - Intergenic
1064977672 10:21135640-21135662 AGTGAGTGATTCCCCCGGCCTGG + Intronic
1065045353 10:21743122-21743144 GCAGAGTGATTCCCCCACTGAGG + Exonic
1065811607 10:29448427-29448449 GCTGAGTTACTCCCCAGGCCAGG + Intergenic
1065960176 10:30727713-30727735 GCTGAGTTACTCCCCAGGCCAGG - Intergenic
1066745426 10:38601862-38601884 GCTAAGTGGTTACCCCATCCAGG + Intergenic
1067154128 10:43760675-43760697 GAAGAGTGATGCCCCCAGCCTGG + Intergenic
1069695791 10:70384399-70384421 GCTGGCTGATGGCCCCAGCCTGG + Intergenic
1070439598 10:76430540-76430562 GCTGAGTGATTTCTCCAGGCAGG + Intronic
1075384058 10:122041796-122041818 GCTGTGGGGTTCCCCCAGCCCGG + Intronic
1075670425 10:124260585-124260607 GCTCAGGGATGTCCCCAGCCAGG - Intergenic
1076056212 10:127375214-127375236 GCGTTGTGATTCCCACAGCCTGG + Intronic
1077111938 11:865825-865847 GGTGAGTGAGACCCCCACCCTGG + Exonic
1077218455 11:1404844-1404866 GCTGAGCCCTGCCCCCAGCCCGG - Intronic
1079241672 11:18726343-18726365 CTTCAGTGTTTCCCCCAGCCTGG - Intergenic
1080377087 11:31725294-31725316 GCTGATGGATTCCCCTTGCCAGG + Intronic
1080586577 11:33688253-33688275 GCACAATAATTCCCCCAGCCTGG - Intergenic
1084687112 11:70703261-70703283 TTTGAGTGAGTCACCCAGCCAGG + Intronic
1084739798 11:71132211-71132233 CCTGGGCGATTCCTCCAGCCTGG - Intronic
1097004003 12:55901952-55901974 GCTGGCTGACTTCCCCAGCCTGG + Exonic
1097621101 12:61940642-61940664 GCAGAGTGATACCCCCAGAATGG + Intronic
1098376558 12:69821761-69821783 GCTGAGTGACTCCACCTGTCGGG + Exonic
1100089617 12:90954326-90954348 GCTGGGTGAAGCCCCCAGGCAGG - Exonic
1101259199 12:103012117-103012139 GCTGAATGATTCTCACAGTCTGG + Intergenic
1101397764 12:104363447-104363469 GCTGAGCGATACCACGAGCCAGG - Intergenic
1104559871 12:129833988-129834010 CCTCAGTGATTCCCCCAACCAGG - Intronic
1104609354 12:130215625-130215647 GAAGAGTGACTGCCCCAGCCTGG - Intergenic
1104889500 12:132133368-132133390 GCAGAGTGAGTCCACCTGCCAGG - Intergenic
1105527749 13:21191808-21191830 CCTGAGTGATCCTCCCATCCTGG + Intergenic
1112586453 13:100722948-100722970 GCAGAGGGCTTGCCCCAGCCCGG + Intergenic
1115922382 14:38390563-38390585 GCTCAGTGATTCGTCAAGCCTGG + Intergenic
1121716971 14:96083361-96083383 GCAGAGTGATGCCCCCACCAAGG + Intronic
1123114164 14:105886420-105886442 GCAGAGTCATTCCCCAACCCTGG + Intergenic
1126753475 15:51901018-51901040 GATGAGTGATTGCCAGAGCCTGG - Intronic
1129171266 15:73809658-73809680 GCTGTCTGCTTCCCCCAGGCTGG + Intergenic
1130106826 15:80935052-80935074 GCTGAGAAAATCCCACAGCCTGG - Intronic
1130888605 15:88114162-88114184 GCTGACTCATTCCCCCACCCAGG - Intronic
1136737647 16:32477787-32477809 GCTGAGTGGTTACCCCGTCCAGG - Intergenic
1139706773 16:68746512-68746534 GATGAGTAAATACCCCAGCCAGG + Intronic
1141642792 16:85351078-85351100 GCAGAGTGATTCACCCCTCCAGG - Intergenic
1203015424 16_KI270728v1_random:351790-351812 GCTGAGTGGTTACCCCGTCCAGG + Intergenic
1203033759 16_KI270728v1_random:624948-624970 GCTGAGTGGTTACCCCGTCCAGG + Intergenic
1142468956 17:151945-151967 GCTGAGGGATTTCCCCAGAGTGG - Intronic
1142889082 17:2931427-2931449 GCTGAGTGATTCCCCCAGCCAGG + Intronic
1143188431 17:5024143-5024165 GCTGTGTGAGTCCCACATCCTGG + Exonic
1143728853 17:8868466-8868488 GGGAAGTGATTCCCACAGCCTGG - Intergenic
1144119543 17:12137554-12137576 GCTGAGACGTTCCCCCAGCATGG + Intronic
1145249996 17:21292041-21292063 GCAGAGTCAGGCCCCCAGCCTGG - Intronic
1147763861 17:42819547-42819569 GCAGATTCATCCCCCCAGCCAGG - Exonic
1148089356 17:45013607-45013629 GCTCAGTGTCTGCCCCAGCCCGG + Intergenic
1149541555 17:57471714-57471736 CCTGCGTGCTGCCCCCAGCCTGG + Intronic
1151406412 17:73889999-73890021 GCTGAGTGGTACCTCCAGCCTGG + Intergenic
1151781839 17:76251857-76251879 GCGGAGTGATTCTCCCAGGGTGG + Intergenic
1152333160 17:79685143-79685165 GCTGAGTGATTCCTCCAGGCGGG - Intergenic
1152678827 17:81655370-81655392 GCCTGGTGATTCCCCCAGCAGGG - Intronic
1154171575 18:12056656-12056678 GCTGTGTGAGTCCCACATCCTGG - Intergenic
1157856625 18:51110460-51110482 GCTGCGTGGTATCCCCAGCCCGG - Intergenic
1158121512 18:54053505-54053527 TCTGAGTGTTTACCCCTGCCAGG - Intergenic
1161007219 19:1942625-1942647 GCTGGGTTTTTCCCCCAGACAGG - Intronic
1161155003 19:2727969-2727991 GCTGAGAGACGCCCCCATCCTGG + Intronic
1161737671 19:6001644-6001666 CATGAGTGAGGCCCCCAGCCAGG + Intronic
1161869872 19:6861890-6861912 CCTGAGTCATTCACACAGCCTGG - Intergenic
1162806678 19:13140813-13140835 GCTGCATGGTTCCCCCACCCTGG + Exonic
1166006477 19:39911095-39911117 GCTGAGCTGTTCTCCCAGCCTGG - Intronic
1166078121 19:40425703-40425725 GCGGCGTGATTCACCCGGCCCGG + Intronic
1166502772 19:43353766-43353788 GGTGAGTGATGAGCCCAGCCTGG + Exonic
1166718823 19:44985983-44986005 GCTTAGAGATTCCGCCACCCAGG - Intronic
1166737830 19:45096714-45096736 AATGAGAGACTCCCCCAGCCTGG - Intronic
1167697548 19:51024218-51024240 ACTGAGTCCTTCCCCCACCCCGG - Exonic
925938640 2:8793272-8793294 GCTGAGTGATCCTCCCACCTTGG - Intronic
926000512 2:9328169-9328191 GGTGAGTGATTGCCGCAGCTTGG + Intronic
926761430 2:16282140-16282162 GCAGAGAGATGCCCACAGCCAGG - Intergenic
929147673 2:38720900-38720922 GCTGTGTGATTTCTGCAGCCAGG - Intronic
931638890 2:64364092-64364114 GCTGAGGAATGCCCCCAGCTGGG - Intergenic
932360911 2:71104803-71104825 GCTGAGTTATCGCTCCAGCCTGG + Intergenic
932368115 2:71166134-71166156 GCTGGGTGATTTCCCCATTCTGG - Intergenic
932887110 2:75558544-75558566 GCTGAGGCTTTCCCCCAACCTGG + Intronic
933965216 2:87427031-87427053 GCTGAGTGGCTCCCCCCGCTTGG - Intergenic
934188771 2:89766900-89766922 GCTGAGTTGTTACCCCATCCAGG - Intergenic
934307821 2:91841053-91841075 GCTGAGTGGTTACCCCGTCCAGG + Intergenic
936623062 2:114120115-114120137 GCTGAGTGAATCAGACAGCCAGG - Intergenic
938072072 2:128314048-128314070 GCACAGTGACACCCCCAGCCTGG + Intronic
941020818 2:160407183-160407205 GCTGGGTGAAGCCCCCGGCCCGG + Intronic
941491924 2:166153275-166153297 GCTGAGATATTCCCCTAGCTGGG + Intergenic
943234487 2:185300339-185300361 GCTGAGTAAGCCCCACAGCCTGG - Intergenic
944803815 2:203261518-203261540 GCTCAGTGATCACTCCAGCCTGG + Intronic
945348966 2:208753581-208753603 GCTCAGTGATTTCCCCACCTTGG + Intronic
946322960 2:218964173-218964195 GCTGAGTCATTGCTCCAGCTGGG - Intergenic
946739143 2:222784924-222784946 GCAGAGTGTGTCCCCAAGCCAGG + Intergenic
948461608 2:238132457-238132479 GCTGAGAGAGTCCTCCAGGCAGG + Exonic
948997718 2:241592185-241592207 GCTCAGAGAGGCCCCCAGCCTGG - Intronic
1169138679 20:3213886-3213908 GCTGAGGGCTGGCCCCAGCCTGG + Intronic
1169430404 20:5531289-5531311 GCTGCTTGCTTTCCCCAGCCAGG + Intergenic
1172151323 20:32792544-32792566 ACCCAGGGATTCCCCCAGCCAGG - Intronic
1173188057 20:40856511-40856533 GCTGTGTGGTTCCACCACCCTGG - Intergenic
1174162195 20:48559380-48559402 GCTGAGAGATTTCCCACGCCAGG + Intergenic
1174286147 20:49475017-49475039 TCTGAGTTATACCCCCAGCCAGG + Intronic
1174534706 20:51242035-51242057 GCTGTGTTATTCCCTCAGCCAGG + Intergenic
1174816046 20:53688117-53688139 GCTCAGTGATTCTCCCACCTTGG + Intergenic
1175571961 20:60030203-60030225 GCTGGGTGACTTCCCCAGTCTGG + Intronic
1178429691 21:32508504-32508526 GCTATGTGATTCCCCCACCAGGG + Intronic
1180534907 22:16388135-16388157 GCTGAGTGGTTACCCCGTCCAGG + Intergenic
1180535204 22:16389553-16389575 CCTGAGTGATCTCCCCAGACCGG - Intergenic
1181630699 22:24149790-24149812 GCTGTGTGCTTTCTCCAGCCTGG - Intronic
1182505987 22:30782896-30782918 GCTGATTCTGTCCCCCAGCCTGG - Intronic
1185136543 22:49076590-49076612 GCTGAGTGATCCGCAAAGCCAGG - Intergenic
950114000 3:10438775-10438797 CCTGAGTCATCCACCCAGCCTGG - Intronic
950650536 3:14404009-14404031 GCTGATTTATTTCCCCAGACAGG - Intronic
952457813 3:33490505-33490527 GCTCAGTTATTTCCCCAGCCTGG - Intergenic
952893136 3:38057698-38057720 AGTGAGTGATTTCCCCAGCTGGG + Intronic
953384531 3:42499147-42499169 GAGCAGTGACTCCCCCAGCCAGG + Intronic
955414890 3:58683017-58683039 TCTGACTGATTCCTCCAGCTGGG + Intergenic
961878617 3:130043643-130043665 GCTACGTGATTCCCCCACCAGGG - Intergenic
963602973 3:147393260-147393282 ACTGAGTGATACCGGCAGCCGGG + Intronic
966909944 3:184553646-184553668 ACTGTGTGATTCCCCAAGGCAGG - Intronic
968130854 3:196192120-196192142 GCCGAGTGCTTCCCCAGGCCTGG + Intergenic
968289324 3:197526536-197526558 GCAGCGTGCCTCCCCCAGCCGGG + Intronic
968655715 4:1777695-1777717 GCTCTGTGCTACCCCCAGCCTGG + Intergenic
969244933 4:5925772-5925794 GCTCAGTGCTTCCCCAACCCTGG - Intronic
969824495 4:9746832-9746854 GCTACGTGATTCCCCCACCAGGG + Intergenic
971096381 4:23409300-23409322 TCTGAGGGAGTCCCACAGCCTGG - Intergenic
972377304 4:38484893-38484915 GCAGTGTGATTCCCCCAGCTTGG - Intergenic
974489419 4:62545455-62545477 GCAGAGTGACTCCACCAGCCTGG - Intergenic
984893758 4:184517007-184517029 GATGAGTGATTACCACAGTCAGG - Intergenic
985631127 5:1014641-1014663 GGTGTGTGTTTCCCCCAGTCGGG - Intronic
985718306 5:1475393-1475415 GGTGGGTGGTTCTCCCAGCCAGG - Intronic
993998540 5:94751115-94751137 TCTGAGTGATTACTTCAGCCCGG - Intronic
997136376 5:131330558-131330580 GGAGAGTGATTCCCCCAGTTGGG - Intronic
998161177 5:139813771-139813793 GCTCGGTGGTTCTCCCAGCCTGG - Intronic
1000169123 5:158684419-158684441 GCTGAGTGATTCTCCCATCAGGG + Intergenic
1003365567 6:5471745-5471767 GCTGGATGATTCCCCAAGGCAGG + Intronic
1006378928 6:33686793-33686815 GCTGAGTGTTTGCCACAGCGGGG + Intronic
1006387409 6:33739019-33739041 TCTCACTGATACCCCCAGCCAGG - Intronic
1007227574 6:40325706-40325728 ACTGACTGATTCCAGCAGCCAGG - Intergenic
1008594827 6:53031456-53031478 GCTGTGTGTTTTGCCCAGCCAGG - Intronic
1011625721 6:89281992-89282014 GCTGAGTGACTGCCCCCACCAGG - Intronic
1012401127 6:98843570-98843592 GCTGAGTGATTTCCTCTCCCGGG - Intergenic
1012937169 6:105380269-105380291 GCCAAGTTATTCCCCCTGCCAGG - Intronic
1017760748 6:157566307-157566329 ACTGAGAGACACCCCCAGCCTGG - Intronic
1019556687 7:1635089-1635111 TGTGAGTGATGCACCCAGCCAGG + Intergenic
1019597309 7:1864123-1864145 GCGGAGGAATTCCCGCAGCCCGG + Intronic
1019656466 7:2198707-2198729 GCTGAGTGACTCTCCCAGGGAGG + Intronic
1020313666 7:6888628-6888650 GCTACGTGATTCCCCCACCAGGG - Intergenic
1023592519 7:41794899-41794921 TCTGTGTGATTCCCCCAGGCTGG + Intergenic
1024058015 7:45678114-45678136 GCTGAGGGCTTCCTCCAGCCAGG - Intronic
1024607605 7:51035104-51035126 GCTGACCGATCCACCCAGCCGGG + Intronic
1029364149 7:100106590-100106612 GCTGCCTGGTTCCCCCAGCGTGG + Intronic
1029440012 7:100582336-100582358 GCTGTGAGATTCCCCAAGGCTGG + Exonic
1029535744 7:101156464-101156486 GCTGGGTGTTTCCACCAGCAGGG - Intronic
1030063787 7:105643539-105643561 GCTCAGCTAGTCCCCCAGCCCGG + Intronic
1034346721 7:150389773-150389795 GATGAGTGGTTCCCTCAGTCTGG - Intronic
1038327587 8:26583958-26583980 TCATAGTGGTTCCCCCAGCCAGG - Exonic
1039128228 8:34229357-34229379 GCTGAGCCATTCACCCATCCTGG - Intergenic
1044820128 8:96150377-96150399 GATGGGTGATTCTCCCTGCCTGG - Intronic
1047555038 8:125920214-125920236 CCTGAGTGTTTCCACCATCCAGG - Intergenic
1048338761 8:133522988-133523010 GCTGAATGTCTCCCCCAGCAAGG - Intronic
1052986352 9:34490905-34490927 GCTGAGAGGCTCCCTCAGCCTGG - Intronic
1055501547 9:76906585-76906607 GCTGAGTGCCTCCCCCGGCCAGG - Intergenic
1059320142 9:113463031-113463053 GGTGGGTGAATCCCCCAGCCTGG - Intronic
1061509364 9:131051036-131051058 GGTAAGAAATTCCCCCAGCCAGG + Intronic
1061583077 9:131549383-131549405 GCCGAGGAATGCCCCCAGCCCGG + Intergenic
1185647104 X:1623684-1623706 GCTCAAGGAATCCCCCAGCCTGG - Intronic
1189255145 X:39632157-39632179 GGTGTGTGTTTCCCCCAGCCAGG - Intergenic
1191790836 X:64970400-64970422 TCTGAGTCAATCCCCAAGCCAGG + Intronic
1192271336 X:69582557-69582579 GATGACTGGTTCCTCCAGCCTGG + Intergenic
1200827353 Y:7658626-7658648 GCTGAGTTCTTCCACCTGCCAGG - Intergenic