ID: 1142891681

View in Genome Browser
Species Human (GRCh38)
Location 17:2948024-2948046
Sequence CAGGACACACGGAGGGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 1, 2: 3, 3: 36, 4: 283}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142891681_1142891693 -7 Left 1142891681 17:2948024-2948046 CCTTGTCCCCTCCGTGTGTCCTG 0: 1
1: 1
2: 3
3: 36
4: 283
Right 1142891693 17:2948040-2948062 TGTCCTGGATTGGGGTGGGCGGG 0: 1
1: 0
2: 4
3: 36
4: 408
1142891681_1142891696 14 Left 1142891681 17:2948024-2948046 CCTTGTCCCCTCCGTGTGTCCTG 0: 1
1: 1
2: 3
3: 36
4: 283
Right 1142891696 17:2948061-2948083 GGAATAACGAGGCGATTGCAAGG 0: 1
1: 0
2: 0
3: 1
4: 43
1142891681_1142891692 -8 Left 1142891681 17:2948024-2948046 CCTTGTCCCCTCCGTGTGTCCTG 0: 1
1: 1
2: 3
3: 36
4: 283
Right 1142891692 17:2948039-2948061 GTGTCCTGGATTGGGGTGGGCGG 0: 1
1: 0
2: 2
3: 66
4: 606
1142891681_1142891695 3 Left 1142891681 17:2948024-2948046 CCTTGTCCCCTCCGTGTGTCCTG 0: 1
1: 1
2: 3
3: 36
4: 283
Right 1142891695 17:2948050-2948072 TGGGGTGGGCGGGAATAACGAGG 0: 1
1: 0
2: 1
3: 14
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142891681 Original CRISPR CAGGACACACGGAGGGGACA AGG (reversed) Intronic
900569298 1:3350546-3350568 CAGGACAAGGGGAGGGGACCAGG + Intronic
900711782 1:4119091-4119113 CAGGACACCGGGTGGGGGCATGG - Intergenic
900798897 1:4725783-4725805 GAGGACACGGGGAGGAGACAGGG - Intronic
902233696 1:15044276-15044298 CAGAACACAAGCAGGGGGCAGGG + Intronic
903051727 1:20606142-20606164 CAGGACACACCTCGGTGACAGGG - Intronic
903051894 1:20607349-20607371 CAGGACACACCTCGGTGACAGGG - Intronic
903345132 1:22679656-22679678 AAGGAGCCACGCAGGGGACAAGG + Intergenic
904616955 1:31755141-31755163 CAGGAGACCTGGAGGGAACAGGG - Intronic
905508292 1:38498135-38498157 CAGGGCACGTGGAGGGGACTCGG - Intergenic
907606412 1:55822178-55822200 CAGGACAAATGGCAGGGACATGG + Intergenic
907926963 1:58964383-58964405 CAAGACACAAGGAGGGGCCATGG - Intergenic
911016146 1:93334956-93334978 CAACACACACAGAGGGGAAATGG - Intergenic
911485397 1:98498637-98498659 CAAGACACATGGAGAGAACATGG + Intergenic
915314644 1:155021489-155021511 CAGGAGAGTGGGAGGGGACAGGG - Intronic
915913966 1:159930363-159930385 CAGACCCCGCGGAGGGGACAGGG + Exonic
915979752 1:160412626-160412648 AAGGACACACTTAGAGGACAGGG - Intronic
916189612 1:162166384-162166406 CAGGACATACTCAGGGCACAAGG - Intronic
916544584 1:165791378-165791400 CAGGAAATACAGAGGGTACAGGG + Intronic
916723373 1:167502044-167502066 CCGGAGATAAGGAGGGGACAGGG + Intronic
919632716 1:199974570-199974592 CAGGAGTCAGGAAGGGGACAGGG + Intergenic
920263367 1:204704564-204704586 GAGGACACCCGGAGTGCACAGGG + Intergenic
920943818 1:210509687-210509709 CAGCACACACAGAGTGGAGAAGG - Intronic
921564286 1:216698016-216698038 AGGGGCAAACGGAGGGGACAGGG - Intronic
922208247 1:223467609-223467631 CAGGACAGATGGAAGGGACTGGG - Intergenic
1067058174 10:43064459-43064481 GAGGGCACACGAAGGGGGCAGGG + Intergenic
1067346213 10:45440819-45440841 CAGGACACGCGGCTGGGGCATGG + Intronic
1067479041 10:46583717-46583739 CTGGACACCTGGGGGGGACAAGG - Exonic
1067615697 10:47758084-47758106 CTGGACACCTGGGGGGGACAAGG + Intergenic
1069914345 10:71778163-71778185 GGGGACACAGGGAAGGGACAAGG - Intronic
1070414976 10:76180929-76180951 CAGGACACAAGGAGGTCTCAGGG + Intronic
1074720456 10:116259934-116259956 CAGGACACACGGCAGGGGAAGGG + Intronic
1075103147 10:119519803-119519825 CAGAATTCACGGAGGGGACAGGG - Intronic
1076723845 10:132404442-132404464 CAGGACATACGTAGGGAGCATGG + Intronic
1077063200 11:626633-626655 CAGGACAGAAGGAGGGGTCTGGG + Intronic
1077219271 11:1408235-1408257 CTGGACACAGGGAGGGGAACTGG - Intronic
1077279008 11:1733550-1733572 TGGGACAAACGCAGGGGACAGGG - Exonic
1077523789 11:3051789-3051811 CAAGGCTCAGGGAGGGGACAGGG - Intronic
1077549469 11:3193643-3193665 CCCGACACTCAGAGGGGACAGGG + Intergenic
1079130931 11:17746546-17746568 AAGGGGACAAGGAGGGGACAGGG - Intronic
1079632547 11:22695457-22695479 CAGGAAACAGGGAGGGTACATGG - Intronic
1080458210 11:32433782-32433804 CAGGATACAAGGAGGGAACTCGG - Intronic
1083310358 11:61780720-61780742 CAGGAGACAGGAAGTGGACACGG - Exonic
1083920208 11:65778341-65778363 CAGGACACAGGCAGGGCACATGG + Exonic
1084658681 11:70534561-70534583 CAGGACACAGGGCTGGGACAAGG + Intronic
1085460358 11:76689647-76689669 CAGGACACAGGGAGGAGAACAGG + Intergenic
1086063537 11:82723972-82723994 CAGCACACATAAAGGGGACAGGG + Intergenic
1086399290 11:86447494-86447516 CAGGACACAGGGAGATGCCAGGG + Intronic
1089647430 11:119889433-119889455 CATCACACACTGAGGGGACTGGG - Intergenic
1090268246 11:125368294-125368316 CAGGACACAGGGCGAGGAAAGGG - Intronic
1092215324 12:6678049-6678071 CAGAACACAATGAGGGTACAGGG + Intronic
1092458897 12:8669707-8669729 CAGGACAGAAGGAAGAGACATGG + Intergenic
1094492888 12:30972238-30972260 CAGGTCACACCAAGGGCACAGGG + Intronic
1096257512 12:50072414-50072436 CAGAACACACAGAGGGGCCAGGG + Intronic
1100346579 12:93737698-93737720 CAGGCAGCACGGAGTGGACAAGG - Intronic
1100863878 12:98835040-98835062 CAGGACTCAGGGAGGGGGCAAGG - Intronic
1101735509 12:107460016-107460038 CAGGGCACCAGGAGGGTACAGGG - Intronic
1101921536 12:108937213-108937235 CAGGGCACAGGGAGTGGAAAGGG + Intronic
1102298456 12:111754819-111754841 CAGCACACACTGAAGGGATAAGG - Intronic
1102797344 12:115700255-115700277 CAGGACAAGCTCAGGGGACATGG + Intergenic
1103195858 12:119043348-119043370 CTGGACACAGGGAGGGGAACAGG + Intronic
1103763619 12:123267596-123267618 CAGGACACAGGGAGAGGGGATGG - Intronic
1103923372 12:124410900-124410922 GAGGACAGACGGAGGAGGCAGGG + Intronic
1104092761 12:125529522-125529544 CAGGACACACAGAGGTGGGAAGG - Intronic
1104797528 12:131529820-131529842 GTGGAACCACGGAGGGGACAGGG + Intergenic
1104888560 12:132127029-132127051 CAGGACACACGAAGTGCGCATGG - Intronic
1104956548 12:132469344-132469366 AAGGACACACGACGGGGAAAGGG + Intergenic
1105870671 13:24503439-24503461 CAGGGAACAGGGAGGGGACAGGG + Intronic
1111106348 13:83650371-83650393 GAAGACACAGGGAGGAGACAGGG - Intergenic
1114650891 14:24284047-24284069 CAGGACACACTGAGGGGGCAAGG + Intergenic
1116658719 14:47681063-47681085 CAGGACAAGGGGAGAGGACAAGG - Intergenic
1118854364 14:69610087-69610109 CAAGGCTCAGGGAGGGGACAAGG - Intergenic
1119535274 14:75397793-75397815 CAGTTCAGACAGAGGGGACAAGG + Intergenic
1119797645 14:77413708-77413730 AAGGGCACAGGGAGGAGACATGG + Intronic
1120878206 14:89393849-89393871 CAGGAAACTGGGTGGGGACAAGG + Intronic
1121802834 14:96789144-96789166 CAGGGAGCAGGGAGGGGACACGG + Intergenic
1122922336 14:104885196-104885218 CAGGACATGCGGATGGGATACGG - Intronic
1122942815 14:104990024-104990046 CACCACACACAGAGGGCACACGG - Intronic
1123049199 14:105532497-105532519 CAGGAATCAGTGAGGGGACAAGG - Intergenic
1202848649 14_GL000225v1_random:1858-1880 CAGGACACGGGGTTGGGACAGGG + Intergenic
1123457480 15:20439167-20439189 CAGGGCACAGGGAAGGGAGACGG + Intergenic
1123457491 15:20439229-20439251 CAGGACACAGGGAAGGGAGATGG + Intergenic
1123457504 15:20439291-20439313 CAGGACACAGGGAAGGGAGACGG + Intergenic
1123457531 15:20439415-20439437 CAGGACACAGGGAAGGGAGACGG + Intergenic
1123660540 15:22561006-22561028 CAGGACACAGGGAAGGGAGACGG - Intergenic
1123660567 15:22561130-22561152 CAGGACACAGGGAAGGGAGACGG - Intergenic
1123660578 15:22561192-22561214 CAGGGCACAGGGAAGGGAGACGG - Intergenic
1124035806 15:26052818-26052840 CAGGACACAGGGCAGGTACATGG - Intergenic
1124263638 15:28214378-28214400 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124263650 15:28214440-28214462 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124263662 15:28214502-28214524 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124263676 15:28214564-28214586 CAGGGCACAGGGAAGGGAAACGG + Intronic
1128155057 15:65386688-65386710 CAGGACAGAGGAAGGGCACAGGG + Intronic
1128213498 15:65918086-65918108 CAGCACACACTGTGGGCACAGGG + Exonic
1130027939 15:80285991-80286013 GAGGACAGACAGAGGGGTCAGGG - Intergenic
1130527009 15:84716091-84716113 CAGGACACCGGCAGGGGAAAGGG + Intronic
1130537926 15:84800133-84800155 CTGGACACAAGTAGGGGATAAGG + Intronic
1130619973 15:85452762-85452784 CAGGACACTGAGAGGGAACATGG - Intronic
1130960174 15:88653772-88653794 CAGGACACAAGGAGCTAACATGG + Intronic
1132004938 15:98218443-98218465 AAGGACACGGGGAGGAGACAGGG - Intergenic
1132208406 15:100002487-100002509 CAGGACACACTGGGGGGACGAGG + Intronic
1132561983 16:599468-599490 CAGCGCACACGGAGGAGGCACGG - Intronic
1132867763 16:2102380-2102402 CAGGAAACACAAAGCGGACATGG + Exonic
1133099321 16:3469724-3469746 CAGGCCACCCGGAGGACACAGGG - Intronic
1134815004 16:17198481-17198503 GAAGACACAGAGAGGGGACAGGG - Intronic
1135134998 16:19880923-19880945 CTAGACACTCGGAGGGGACATGG - Intronic
1135249874 16:20891848-20891870 CCGTTCACAAGGAGGGGACAGGG - Intronic
1136075407 16:27813774-27813796 CAGGAAACACGGAGGGGACAAGG + Intronic
1136511546 16:30740745-30740767 GAGGACACAAGGAGGGCCCAGGG - Exonic
1136580481 16:31148476-31148498 CAGGCCACACGGCGGGGCCCAGG + Exonic
1136701979 16:32152689-32152711 CAGGACACAGGGAAGGGAGATGG + Intergenic
1136765686 16:32774771-32774793 CAGGACACAGGGAAGGGAGACGG - Intergenic
1136802412 16:33095607-33095629 CAGGACACAGGGAAGGGAGACGG + Intergenic
1137028212 16:35499157-35499179 CAGGACACACGTATGAGCCATGG - Intergenic
1137063061 16:35809785-35809807 CAGGAGAAAAGGAGGGGAGAGGG + Intergenic
1137516687 16:49150564-49150586 CAGGACTCTCCCAGGGGACATGG + Intergenic
1137920097 16:52478442-52478464 CAAGAGACAAGGAGGGCACATGG - Intronic
1138261096 16:55623337-55623359 CACGAGACACCGAGGGGAGATGG + Intergenic
1138345042 16:56315567-56315589 CTGGACCCACTGAGGGGAGAAGG + Intronic
1139908220 16:70381020-70381042 CCGGACAGGTGGAGGGGACAGGG - Exonic
1141140160 16:81492260-81492282 AATGACACCCGGAGAGGACATGG - Intronic
1141621426 16:85238496-85238518 CAGGACACACGCCGAGGCCAGGG - Intergenic
1141675923 16:85517270-85517292 GAGGACACACGCAGGGGCCTAGG + Intergenic
1142116001 16:88356369-88356391 CAGTACACAGGGAGGGGGCAGGG + Intergenic
1203068075 16_KI270728v1_random:1037019-1037041 CAGGACACAGGGAAGGGAGACGG - Intergenic
1142744757 17:1950277-1950299 CAGGACACACTGACGGATCAGGG + Intronic
1142891681 17:2948024-2948046 CAGGACACACGGAGGGGACAAGG - Intronic
1144945079 17:18965681-18965703 CAGTACACAGGGAGGGAGCAAGG - Intronic
1148166938 17:45490429-45490451 CTGGACAGACGGAGGGGACGGGG + Intronic
1149868596 17:60163779-60163801 CAGGACACAGGGAAGGGATGTGG + Intronic
1150398117 17:64836833-64836855 CTGGACAGACGGAGGGGACGGGG + Intergenic
1150635633 17:66911379-66911401 CAGGAAACAGGAGGGGGACATGG - Intergenic
1150714056 17:67556544-67556566 CAGGGCACACTGATGGGCCAAGG + Intronic
1151363788 17:73604369-73604391 CAGGGCACAGGGAAGGGACCTGG + Intronic
1151732887 17:75921563-75921585 GAGGACACAGGGATGGGGCATGG + Intronic
1152078241 17:78171437-78171459 CAGGACTCTGGGAGGGGACGCGG - Intronic
1152137275 17:78511974-78511996 CAGGCCACCCTGAGGGCACAGGG - Intronic
1152234439 17:79131270-79131292 GAATACACACGGAGGGCACATGG - Intronic
1152234443 17:79131292-79131314 CACAGCACACGGAGGGCACATGG - Intronic
1152260143 17:79262372-79262394 CAGATCCCACTGAGGGGACACGG + Intronic
1152648631 17:81481819-81481841 CAGGACACAGGGAGAAGACAAGG - Intergenic
1152885218 17:82845467-82845489 CAGGACAGACGGAGAGGAAGGGG - Intronic
1152885244 17:82845558-82845580 CAGGACAGACGGAGAGGAAGGGG - Intronic
1155545906 18:26914648-26914670 TAGGAGACACAGATGGGACACGG + Exonic
1157290560 18:46406636-46406658 CAGGGCACACTGAGGGCACCCGG - Intronic
1157916359 18:51667544-51667566 CAGGACACGGGGAAGGGAGAAGG + Intergenic
1159596115 18:70384262-70384284 CAGGACTCACTGAGGAGCCAGGG - Intergenic
1159922511 18:74238370-74238392 CAGGACACACTGAGGAGCCGGGG + Intergenic
1160440890 18:78891549-78891571 CAGGACAGACAGATGTGACATGG - Intergenic
1160993030 19:1868411-1868433 GAGGTCACACTGAGGTGACAGGG - Intergenic
1162362531 19:10228649-10228671 CCTTACACAGGGAGGGGACATGG - Intronic
1162745184 19:12793895-12793917 CAGGTCAGACGGAGGGGGCGTGG - Intronic
1162909310 19:13840781-13840803 CAGGACACCAGGAGGGAAGAAGG + Intergenic
1164102136 19:22065711-22065733 CAGGACAAACACAGGTGACATGG + Intronic
1164735717 19:30539663-30539685 TAGTGCACAGGGAGGGGACATGG - Intronic
1165484671 19:36088525-36088547 CAAGGCACACAGAGAGGACAGGG - Intronic
1167074239 19:47239489-47239511 CCGGCCACACCGAGGGGACCCGG - Intergenic
1167327070 19:48833206-48833228 CAGGAGACAGGAAGGAGACAGGG + Intronic
925395002 2:3527084-3527106 CGGGACACAGGGAGGGCGCAGGG + Intergenic
925424536 2:3737609-3737631 CAGGCCACATGGAGGCCACATGG - Intronic
925754352 2:7119525-7119547 CAGGAGACAAGGAGGGGATTCGG - Intergenic
925836420 2:7951202-7951224 CAGGCCACACGGCGGGGGCTGGG - Intergenic
927680185 2:25133770-25133792 CAGGGGACACAGAGGGGAAAAGG - Intronic
931248891 2:60513293-60513315 TATGAGACAAGGAGGGGACAAGG + Intronic
932188732 2:69720770-69720792 CAGGAATCACTGAGGGGACCTGG - Intronic
932269216 2:70394504-70394526 ATGGACACATGGTGGGGACAGGG - Intergenic
932407384 2:71522535-71522557 CAGGACACAGCAAGGGAACAGGG - Intronic
932463475 2:71898182-71898204 CAGGACACACGGAGCTGAGGAGG - Intergenic
932842413 2:75095814-75095836 AAGGGCACACAGAAGGGACAGGG - Intronic
934992353 2:98930474-98930496 CAGGACAGAGGGTGGGGACGGGG - Intronic
936057504 2:109272046-109272068 CATGACACAGGGATGGGACAGGG - Intronic
936087500 2:109479255-109479277 CAGCACACAGGGTGGGGACACGG + Intronic
936557936 2:113512091-113512113 CAAGACCCAGGGAGGGGAGAGGG + Intergenic
937107514 2:119331651-119331673 CAGGCCACAGGGCGGGGAGAGGG - Intronic
939381258 2:141440113-141440135 CATGCCACAGGGAGGGGACTCGG - Intronic
940767868 2:157809509-157809531 CAGAAAACAAGGAGGAGACAGGG + Intronic
942453398 2:176122358-176122380 CAGGGCACACGGAGCGGCCGCGG - Intergenic
946312390 2:218890038-218890060 CAGGGCACACGCATTGGACACGG - Exonic
947800727 2:232927591-232927613 CAGGCCACACGGCGCGGAAAGGG + Intronic
947932657 2:233976442-233976464 GAGGACACAGGGCAGGGACATGG + Intronic
948370240 2:237484281-237484303 CAGGACACAGGGAGAGGACCCGG + Intergenic
948606724 2:239140706-239140728 CAGGTCAGAAGGAAGGGACATGG + Intronic
1168947148 20:1770641-1770663 CAGCACACAGGGAGAGCACAGGG + Intergenic
1172153746 20:32809384-32809406 CAGGTCAGATGGATGGGACATGG + Intergenic
1173596052 20:44258944-44258966 CAGGACAAGAGTAGGGGACAGGG - Intronic
1175578347 20:60079475-60079497 GAGCTCACACGGAGGGGTCAGGG - Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1175826948 20:61941695-61941717 CAGGAGGCACGGAGGGCAGAGGG - Intergenic
1175877502 20:62237268-62237290 CAGGACGCACTGCGGGGTCACGG + Intronic
1175893733 20:62326974-62326996 CAGGACAGACAGAGGTGACCTGG + Intronic
1176213975 20:63939577-63939599 CTGGACCTAGGGAGGGGACAGGG - Intergenic
1176296668 21:5076743-5076765 CAGGGCACCCGGAGGGCACGGGG + Intergenic
1178666096 21:34547731-34547753 CAGGAGACAGGGAGAGGACATGG - Intronic
1179084694 21:38206690-38206712 CAGGACACTTGGATGGAACAGGG - Intronic
1179584868 21:42368014-42368036 CAGGACCCAGGGAGGGGCCGAGG + Intergenic
1179860381 21:44185378-44185400 CAGGGCACCCGGAGGGCACGGGG - Intergenic
1179973202 21:44847685-44847707 CAGGACAGATGGAGGGGAGTGGG - Intergenic
1179990854 21:44947669-44947691 CAGGGCACAGGAAGGGAACAGGG - Intronic
1180800838 22:18631128-18631150 CAGGGCACACTGAGGGGAACAGG + Intergenic
1180852071 22:19026685-19026707 CAGGGCACACTGAGGGGAACAGG + Intergenic
1181220879 22:21364134-21364156 CAGGGCACACTGAGGGGAACAGG - Intergenic
1181415474 22:22755776-22755798 CAGGACCCAGGGTGGGGACAAGG + Intronic
1181849191 22:25737644-25737666 CAGGACACACGAAGGCCACTGGG + Intergenic
1183172535 22:36198762-36198784 CAGGTCACACAGAGGGGACATGG + Intronic
1183177129 22:36232594-36232616 CAGGTCACACAGAAGGGACTTGG + Intronic
1183180711 22:36257946-36257968 CAGGTCACACAGAGGGGATGTGG - Intronic
1183283863 22:36950639-36950661 CTGGGCACACAGTGGGGACAGGG + Intergenic
1183356889 22:37364447-37364469 GAGGGCACTCAGAGGGGACAGGG + Intergenic
1184090480 22:42290545-42290567 CAGGCCACACTGTGGGGAGAGGG - Intronic
1184636494 22:45836401-45836423 CAGGAGACAGGGAGGGGGCCAGG - Intronic
1184769757 22:46590186-46590208 CAGGAGGCACGCAGGGCACAGGG - Intronic
1185020784 22:48373673-48373695 CAGGCCACAGGAAGGGGACCTGG + Intergenic
950885985 3:16363208-16363230 GAGGAGACAAGGAGTGGACAAGG - Intronic
951412263 3:22379482-22379504 AAGGACAAAAGGAGGGGAGAGGG + Intergenic
952069697 3:29619107-29619129 ATGGACACAGGGAGGGGAAAGGG + Intronic
954181668 3:48886139-48886161 CAGGGCAGAAGGAGGGGATAGGG + Intronic
954575062 3:51671376-51671398 CGGGGGTCACGGAGGGGACACGG - Exonic
954901291 3:54022204-54022226 CAGGATAGACAGAGGGAACAGGG + Intergenic
955859342 3:63310944-63310966 CAGGACACACTGAGAGTACAGGG - Intronic
956979065 3:74614918-74614940 GAGGCCACCCGGAGGTGACACGG - Intergenic
957100822 3:75826320-75826342 CAAGACACACGAAGGAGACAAGG + Intergenic
961381360 3:126498323-126498345 TGGGACACAGAGAGGGGACAGGG - Intronic
961754542 3:129120371-129120393 CAGGACACCCTCAGGGCACAGGG - Intronic
962204770 3:133425751-133425773 CAGGACAAAGGGATGGGAAAGGG + Intronic
963291684 3:143496707-143496729 CAGGAAAAATGTAGGGGACAGGG + Intronic
965458066 3:168929204-168929226 CATGAGACTTGGAGGGGACAGGG - Intergenic
965743182 3:171898093-171898115 CAAGACAGAGGGAAGGGACAAGG + Intronic
965787650 3:172352876-172352898 CAGGACACAGAGAGTGGAGACGG - Exonic
967294084 3:187948563-187948585 CAGGAGGCATGGAGGTGACAGGG + Intergenic
967321819 3:188201944-188201966 CAGGTCAAGCAGAGGGGACAAGG + Intronic
968563718 4:1298296-1298318 CAGGTCACAGGGATGGGGCAGGG - Intronic
968673313 4:1863923-1863945 CAGGACACAGGGAGGGAAGTGGG + Intergenic
968816205 4:2823200-2823222 CAGGACACGCGGAGAGGGCGAGG - Intronic
969906711 4:10403856-10403878 CAGGAAGCACTGAGGGGTCATGG + Intergenic
971264808 4:25088244-25088266 CTGGAGAGATGGAGGGGACAGGG - Intergenic
973805066 4:54517876-54517898 CAGGACCCACTGAGGAGGCAGGG + Intergenic
975468620 4:74737700-74737722 CAGGAAACAGGGAAGGGAGAGGG + Intergenic
977030537 4:91876842-91876864 CAGGACACACTGATGGAAGAGGG - Intergenic
977105411 4:92876758-92876780 CAGAACACACAGGGAGGACAGGG + Intronic
984921234 4:184766093-184766115 CAGACCACACGGAGGCCACACGG + Intronic
985010191 4:185574068-185574090 CAGGAAACACCCAGGGAACAGGG + Intergenic
985636311 5:1037554-1037576 CAGGACACACAGTGGGGACAAGG + Intronic
988461657 5:31444115-31444137 CAGCACACGGGGAAGGGACAGGG + Intronic
988538514 5:32089300-32089322 CAGCACACACTGGGGGGACCTGG - Exonic
989301203 5:39896079-39896101 GAGGAGACACTAAGGGGACATGG + Intergenic
989351596 5:40493254-40493276 CAGGACACACAGAAAGGAAAGGG + Intergenic
993616933 5:90124496-90124518 CATGACACACACTGGGGACAGGG + Intergenic
993836200 5:92823085-92823107 CAGGAGGGAAGGAGGGGACAAGG + Intergenic
997425535 5:133800256-133800278 CAGTACTCAGGGAGGGGACAGGG + Intergenic
998799654 5:145856446-145856468 CAGGACACTGGGAGAGGAGAGGG - Intergenic
999774557 5:154801978-154802000 TAGGACAGACGAAGGGGAAAAGG - Intronic
1000350429 5:160348429-160348451 CAGGAAAGAGGGAGGGGCCAAGG - Exonic
1000821935 5:165995487-165995509 CCGGAGACACAGAGGGGAGAAGG + Intergenic
1001495474 5:172185191-172185213 CAGGACACACTGCGGGGAAGGGG + Intronic
1001551158 5:172603068-172603090 CAGGGGTCAGGGAGGGGACAGGG + Intergenic
1002311337 5:178315627-178315649 CAGGGCACGGGAAGGGGACAAGG + Intronic
1002791639 6:441571-441593 CAGGACCCACAGAGGGGTCTCGG + Intergenic
1003245393 6:4378272-4378294 CAGGGAAGATGGAGGGGACAGGG + Intergenic
1004285420 6:14316665-14316687 AAGGACACACGCAGGGAGCATGG - Intergenic
1004980383 6:21016769-21016791 GAAGACACACTGAGGGGACCTGG - Intronic
1005090828 6:22055601-22055623 AAGGACATAGGGATGGGACAAGG - Intergenic
1006272505 6:32974965-32974987 AAGGACACATGGAGGGCACAAGG - Intronic
1006296148 6:33170944-33170966 AAGGACACAGGGATGGGTCATGG + Intronic
1006720255 6:36145499-36145521 CAGGACCCTGGGATGGGACAAGG + Intergenic
1006909079 6:37552367-37552389 CAGGGCCCACGGAGGGTAGAGGG + Intergenic
1007764512 6:44152773-44152795 CAGGCCACCCCGAGTGGACAGGG + Intronic
1009705030 6:67239032-67239054 CAGGGGACTCAGAGGGGACAGGG - Intergenic
1011897721 6:92252397-92252419 CAGGACACAGTCATGGGACAGGG + Intergenic
1014163745 6:118200445-118200467 AAGGACACTGGCAGGGGACAGGG - Intronic
1015706597 6:136094511-136094533 AAGGCCACACTGAGGTGACATGG - Intronic
1015748890 6:136540198-136540220 CTGGTCACACGGAAGGGAAAAGG + Intronic
1015859983 6:137665773-137665795 CAGGAGAGACGGAAGGGTCAAGG - Intergenic
1017103142 6:150865886-150865908 CAGGGCACACGGAGGCGGCGCGG - Exonic
1017758649 6:157551207-157551229 CAGGAGGAAGGGAGGGGACACGG - Intronic
1017926829 6:158917891-158917913 CAGGACTCCAGGATGGGACAGGG + Intergenic
1017996334 6:159534566-159534588 CAGGACACTGGCAGGGGAGAAGG + Intergenic
1018110704 6:160534575-160534597 CTGGACACATGAAGGGGAGAGGG + Intronic
1018817092 6:167341504-167341526 CAGGACACACGGGGAGGTCTTGG - Exonic
1018935997 6:168274326-168274348 CAGGACACAAGGACAGGACAGGG + Intergenic
1018985504 6:168633647-168633669 CAGGAGACACAGAAGGGCCAAGG + Intronic
1019298455 7:290984-291006 CAGGGCGCCCCGAGGGGACAAGG + Intergenic
1019598934 7:1871856-1871878 GAGGGGACATGGAGGGGACAGGG + Intronic
1021827844 7:24573021-24573043 CAGGAGACCCGGCGGGGACTGGG + Intergenic
1026640570 7:72120926-72120948 CAGGACTCAGTGAGGGGAAAAGG + Intronic
1026930442 7:74220445-74220467 CATGCCCCACTGAGGGGACAGGG + Intronic
1026991563 7:74588916-74588938 CAGGACACACTTAGGAGACAAGG - Intronic
1031383345 7:121115159-121115181 CAGGGCACATGGAGATGACATGG + Intronic
1031980502 7:128121480-128121502 CAGGACACACGGGGGCCTCAGGG + Intergenic
1034476443 7:151286824-151286846 CAGGAGTTAAGGAGGGGACAGGG + Intergenic
1035302628 7:157907351-157907373 CACCCCACACGCAGGGGACAGGG - Intronic
1035302664 7:157907474-157907496 CACCCCACACGCAGGGGACAGGG - Intronic
1035302710 7:157907640-157907662 CACCCCACACGCAGGGGACAGGG - Intronic
1035637017 8:1155158-1155180 GAGGAGAGACGCAGGGGACACGG - Intergenic
1036663298 8:10722197-10722219 CAGGACACACTGTGGGGGCATGG - Intergenic
1040932366 8:52748394-52748416 CAGCACACCTGGAGAGGACATGG - Intergenic
1041267668 8:56081044-56081066 CAGGACAAAGAGAGGAGACAGGG - Intergenic
1042276671 8:67012285-67012307 CAGGACACATAAATGGGACATGG - Intronic
1048808227 8:138260834-138260856 CAGGACAGAAGGAGGAGACCTGG - Intronic
1048909903 8:139125322-139125344 CAGGAATCAAGGAGCGGACATGG - Intergenic
1049094603 8:140540940-140540962 CAGGACAGAGGGAGGGGAGGAGG - Intronic
1049263541 8:141652838-141652860 CAGGGCAGAGGGAGGGGATATGG - Intergenic
1049267107 8:141674067-141674089 CTCCACACCCGGAGGGGACAGGG - Intergenic
1049410886 8:142473556-142473578 CAGGGCACAAGGGCGGGACAGGG - Intronic
1049503130 8:142978725-142978747 CTGGAGAGACAGAGGGGACATGG + Intergenic
1053417088 9:37953627-37953649 CAGGTCACACGGGGTGGCCATGG - Intronic
1054691226 9:68322634-68322656 CAAGACCCAGGGAGGGGAGAGGG + Intergenic
1057861330 9:98643159-98643181 CTGGGCACTCGGAGGGGAGAGGG + Intronic
1058025032 9:100133269-100133291 CAAGACAGACTGAGGAGACAGGG - Intronic
1059153497 9:111969717-111969739 GAGGACACAGGGAGAGGACGCGG - Intergenic
1059751931 9:117255771-117255793 CAGAACACAGGGAGGGGAGGAGG + Intronic
1060507983 9:124212728-124212750 CAGGACACACACATGGGAGAAGG - Intergenic
1060516963 9:124271959-124271981 CAGGAGACACGGGGAGCACAAGG - Intronic
1061895280 9:133643816-133643838 CAGGACCCACTGAGGGCATAAGG - Intronic
1062090335 9:134674376-134674398 CACGAAAGACGCAGGGGACACGG + Intronic
1062373233 9:136250960-136250982 CAGGACACACGGAGCTGCCAAGG - Intergenic
1062683732 9:137799219-137799241 AAGGGGACAGGGAGGGGACAAGG - Intronic
1185831098 X:3303767-3303789 CAGGAGACACGGAGAGGAGTAGG + Intergenic
1188780647 X:34279898-34279920 CAAAACACAGGGAAGGGACAGGG - Intergenic
1189044742 X:37578465-37578487 CATGACACATGGAGGTGACCTGG - Intronic
1189413150 X:40791445-40791467 CAGGATAGGCGGGGGGGACATGG + Intergenic
1199950728 X:152703840-152703862 CAGGACACATGGAAGTGACCCGG - Intergenic
1199953053 X:152720429-152720451 CAGGACACATGGAAGTGACCCGG - Intergenic
1199956630 X:152748017-152748039 CAGGACACATGGAAGTGACCCGG + Intergenic
1199958954 X:152764621-152764643 CAGGACACATGGAAGTGACCCGG + Intergenic
1200119010 X:153781684-153781706 CAGGACCCACGGCGGGGATCAGG - Intronic