ID: 1142895608

View in Genome Browser
Species Human (GRCh38)
Location 17:2975828-2975850
Sequence AGCCGTGTGCTCCCACGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142895606_1142895608 -4 Left 1142895606 17:2975809-2975831 CCGTTTCATCTTCACACTAAGCC 0: 1
1: 0
2: 4
3: 47
4: 348
Right 1142895608 17:2975828-2975850 AGCCGTGTGCTCCCACGTGGTGG 0: 1
1: 0
2: 0
3: 7
4: 82
1142895605_1142895608 -3 Left 1142895605 17:2975808-2975830 CCCGTTTCATCTTCACACTAAGC 0: 1
1: 0
2: 1
3: 11
4: 165
Right 1142895608 17:2975828-2975850 AGCCGTGTGCTCCCACGTGGTGG 0: 1
1: 0
2: 0
3: 7
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142895608 Original CRISPR AGCCGTGTGCTCCCACGTGG TGG Intronic
902703938 1:18191588-18191610 AGCCGTGTGCTCCCGCGCCAGGG - Intronic
904517273 1:31065948-31065970 GGCCGTGTTCTCCCAGGTGCGGG - Intronic
905445808 1:38027936-38027958 AGCCCTGTGCTCCTGCGTGGTGG + Intergenic
908645086 1:66269343-66269365 AGCCATATGCTCCCAGGTTGAGG + Intronic
920841837 1:209561862-209561884 GTCCATCTGCTCCCACGTGGGGG + Intergenic
1067577675 10:47418552-47418574 TGCCGTGTGATCCCACCTGTGGG + Intergenic
1069425799 10:68287692-68287714 ATCCCTCTGCTCCCAGGTGGTGG + Intronic
1073353723 10:102837344-102837366 AGCCACGAGCTCCCACATGGTGG + Exonic
1074757709 10:116637956-116637978 TGCTGTATACTCCCACGTGGTGG + Intronic
1075710869 10:124529964-124529986 GGCAGTGTGGTCCCAAGTGGGGG + Intronic
1077819251 11:5719822-5719844 AGCCATGTGCTCACAGGAGGTGG - Intronic
1084478709 11:69404092-69404114 AGCTGTGTGCTCCCCTGTAGGGG + Intergenic
1089212321 11:116813921-116813943 TGCCCTGTGCTCCCAGGAGGAGG - Intergenic
1091276628 11:134357279-134357301 AGCCTCGGTCTCCCACGTGGAGG - Intronic
1095099186 12:38163274-38163296 AGCGGTGGACTCCCACGAGGAGG + Intergenic
1098264606 12:68705888-68705910 AGCTGTGTGCACCCAGGTGAAGG + Intronic
1104107870 12:125680651-125680673 AGCCAGGTGCTCCCACTGGGGGG - Intergenic
1104970554 12:132528845-132528867 TGCCATGTGCACCCACGGGGAGG - Intronic
1105845651 13:24291572-24291594 AGCCCTGTGCTCCCAGCAGGAGG - Intronic
1113713673 13:112488620-112488642 ACCCCTGTGCTCCCCTGTGGTGG - Intronic
1113713690 13:112488663-112488685 ACCCCTGTGCTCCCCTGTGGTGG - Intronic
1113713721 13:112488747-112488769 ACCCCTGTGCTCCCCTGTGGTGG - Intronic
1113713789 13:112488915-112488937 ACCCCTGTGCTCCCCTGTGGTGG - Intronic
1122557878 14:102591598-102591620 CCCCGTGTTCTCCCTCGTGGGGG + Intergenic
1122822091 14:104352814-104352836 AGCCGTGGACTCCCATGTAGAGG - Intergenic
1123021039 14:105398178-105398200 CGCCGCGTGCTCCCAAGGGGTGG - Intergenic
1124484786 15:30104248-30104270 AGCCGCGGGCTCCCACCTCGAGG - Intergenic
1124539860 15:30573256-30573278 AGCCGCGGGCTCCCACCTCGAGG - Intergenic
1124758791 15:32434326-32434348 AGCCGCGGGCTCCCACCTCGAGG + Intergenic
1130897353 15:88181781-88181803 AGCTGAGTGATGCCACGTGGAGG - Intronic
1134095450 16:11415624-11415646 AGCCGGGTGCTCCCAGGTGTGGG - Intronic
1142895608 17:2975828-2975850 AGCCGTGTGCTCCCACGTGGTGG + Intronic
1146842551 17:36166049-36166071 AGCAGTGTGCTCCCACCTCAGGG - Exonic
1146854863 17:36254008-36254030 AGCAGTGTGCTCCCACCTCAGGG - Exonic
1146865757 17:36334368-36334390 AGCAGTGTGCTCCCACCTCAGGG + Exonic
1146870763 17:36377900-36377922 AGCAGTGTGCTCCCACCTCAGGG - Exonic
1146878121 17:36428981-36429003 AGCAGTGTGCTCCCACCTCAGGG - Exonic
1146882062 17:36450085-36450107 AGCAGTGTGCTCCCACCTCAGGG - Intergenic
1147068627 17:37934980-37935002 AGCAGTGTGCTCCCACCTCAGGG + Exonic
1147073647 17:37978524-37978546 AGCCGTGTGCTCCCACCTCAGGG - Intronic
1147080149 17:38014517-38014539 AGCAGTGTGCTCCCACCTCAGGG + Intronic
1147085168 17:38058062-38058084 AGCAGTGTGCTCCCACCTCAGGG - Exonic
1147096098 17:38138477-38138499 AGCAGTGTGCTCCCACCTCAGGG + Intergenic
1147101114 17:38182028-38182050 AGCAGTGTGCTCCCACCTCAGGG - Intergenic
1151207614 17:72519453-72519475 GGCCCTGTGATCCCAGGTGGAGG - Intergenic
1153000661 18:452592-452614 AGCTGTGTGCTTCCAAGTGTTGG + Intronic
1156353409 18:36321295-36321317 AGCCCAGTGCTCCCATGTGTGGG + Intronic
1156461331 18:37322927-37322949 AGCCATGTCCTGCCACGTGGTGG - Intronic
1160772434 19:839021-839043 AGCCATGGGCTTCGACGTGGGGG + Intergenic
1160985958 19:1838866-1838888 AGCCTTGTCCTCCCAAGTGCTGG - Intronic
1165802579 19:38562036-38562058 AGAGGTGTGCACCCACGTGTGGG - Intronic
1165940575 19:39413067-39413089 CCCCCTGTGCTCCCACCTGGAGG + Exonic
925116157 2:1379698-1379720 AGCCGTGTCCTGCCAGGAGGAGG - Intronic
925817701 2:7769313-7769335 AGCTGCCTGCTCCCACGTGTGGG - Intergenic
929127726 2:38536260-38536282 AGCCGTGTGGCGCCACCTGGTGG - Intergenic
929580820 2:43080905-43080927 AGCCATGGGCTCCCCAGTGGTGG - Intergenic
932432860 2:71686007-71686029 AGCCCTGGGCTGCCATGTGGGGG + Intronic
933952631 2:87343515-87343537 ACCCTTGTGCTCCCATGTGTGGG + Intergenic
947217915 2:227766474-227766496 TGCCTTGTGCTACCACCTGGTGG + Intergenic
1181854910 22:25774687-25774709 AGGCCTGTGCTCCCACCTGGTGG - Intronic
1182794810 22:32984310-32984332 ATCCTTGTGCTGCCACGTGCTGG - Intronic
1184131266 22:42518082-42518104 CGCCGTGTGCTCTCACATAGAGG + Exonic
1184141488 22:42580294-42580316 TGCCGTGTGCTCTCACATAGAGG + Intergenic
1185103027 22:48851793-48851815 ACCTGTCTGCTCCGACGTGGAGG + Intergenic
953899768 3:46833537-46833559 TGCCGTCAGCACCCACGTGGCGG + Exonic
959561086 3:107782272-107782294 AGCAATGTGCTCCCACCTGCAGG - Intronic
968483096 4:845550-845572 AGCCAAGTCCTCCCACTTGGAGG + Intergenic
968651428 4:1761694-1761716 ACCCTGGGGCTCCCACGTGGAGG - Intergenic
974592667 4:63973865-63973887 AGGCGTGTGCCACCACGTGCGGG - Intergenic
982093489 4:151899652-151899674 AGTTGTGTGGTCCCACATGGTGG + Intergenic
986658601 5:10039216-10039238 AGCTGAGTGCTCCCAAATGGAGG + Intergenic
987446393 5:18024707-18024729 AGCCTTGGGGTCCCATGTGGAGG - Intergenic
990450389 5:55927713-55927735 TGCCGGGTGGTCCCAGGTGGAGG + Intergenic
991712823 5:69424879-69424901 AGGCGTGTGCCACCACGTGCAGG - Intronic
993901548 5:93587590-93587612 ATCTGTGTGTTCCCCCGTGGTGG + Intronic
997385310 5:133467721-133467743 AGCCGTGTGCTCCATCGGGGTGG - Intronic
1002538985 5:179893757-179893779 CTCCGTGCGCTCCCACTTGGGGG - Intronic
1005390074 6:25324051-25324073 AGCCATGGGCTCCCAGATGGAGG - Intronic
1005965376 6:30722787-30722809 AGACGTCTGCTGCCACCTGGTGG + Intronic
1006472937 6:34238176-34238198 GGCCGGGTGCACCCGCGTGGCGG + Intronic
1006825317 6:36930459-36930481 AGCCCTGTGCATCCACGTGATGG + Intergenic
1007924607 6:45641208-45641230 ATCCCTGTGCTCCCAGGTGGTGG + Intronic
1020791976 7:12638377-12638399 AGCCATCTGCTCCCATCTGGTGG + Intronic
1039472987 8:37825748-37825770 AGCTGTGTCCTCCCTCGGGGCGG - Intronic
1040579960 8:48689575-48689597 ATCCATGCGCTCCCAGGTGGTGG - Intergenic
1043494061 8:80780787-80780809 AGGGGTGTGCTCCCTCTTGGGGG - Intronic
1049729437 8:144168362-144168384 TGCCCTGTGCTCCCTCGGGGAGG + Exonic
1052863853 9:33453239-33453261 AGTCATGGGCTCCCACGGGGTGG - Intergenic
1190439911 X:50467169-50467191 AGCCATGGTCTCCCACCTGGTGG - Intronic
1197612374 X:128653741-128653763 AGCCGTGTTTTCCCAGCTGGGGG + Intergenic