ID: 1142899332

View in Genome Browser
Species Human (GRCh38)
Location 17:3002630-3002652
Sequence CTCCCCAGTGGAGGCCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 1, 2: 21, 3: 48, 4: 252}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142899332_1142899338 6 Left 1142899332 17:3002630-3002652 CCCAGGAGGCCTCCACTGGGGAG 0: 1
1: 1
2: 21
3: 48
4: 252
Right 1142899338 17:3002659-3002681 CTGAAGAAAGAAGAGTATAAAGG 0: 1
1: 0
2: 5
3: 50
4: 579
1142899332_1142899340 10 Left 1142899332 17:3002630-3002652 CCCAGGAGGCCTCCACTGGGGAG 0: 1
1: 1
2: 21
3: 48
4: 252
Right 1142899340 17:3002663-3002685 AGAAAGAAGAGTATAAAGGAGGG 0: 1
1: 0
2: 9
3: 191
4: 1934
1142899332_1142899343 20 Left 1142899332 17:3002630-3002652 CCCAGGAGGCCTCCACTGGGGAG 0: 1
1: 1
2: 21
3: 48
4: 252
Right 1142899343 17:3002673-3002695 GTATAAAGGAGGGACAGGGTTGG 0: 1
1: 0
2: 0
3: 22
4: 246
1142899332_1142899344 21 Left 1142899332 17:3002630-3002652 CCCAGGAGGCCTCCACTGGGGAG 0: 1
1: 1
2: 21
3: 48
4: 252
Right 1142899344 17:3002674-3002696 TATAAAGGAGGGACAGGGTTGGG 0: 1
1: 0
2: 2
3: 23
4: 321
1142899332_1142899339 9 Left 1142899332 17:3002630-3002652 CCCAGGAGGCCTCCACTGGGGAG 0: 1
1: 1
2: 21
3: 48
4: 252
Right 1142899339 17:3002662-3002684 AAGAAAGAAGAGTATAAAGGAGG 0: 1
1: 0
2: 5
3: 113
4: 1198
1142899332_1142899342 16 Left 1142899332 17:3002630-3002652 CCCAGGAGGCCTCCACTGGGGAG 0: 1
1: 1
2: 21
3: 48
4: 252
Right 1142899342 17:3002669-3002691 AAGAGTATAAAGGAGGGACAGGG 0: 1
1: 0
2: 2
3: 24
4: 357
1142899332_1142899341 15 Left 1142899332 17:3002630-3002652 CCCAGGAGGCCTCCACTGGGGAG 0: 1
1: 1
2: 21
3: 48
4: 252
Right 1142899341 17:3002668-3002690 GAAGAGTATAAAGGAGGGACAGG 0: 1
1: 0
2: 2
3: 20
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142899332 Original CRISPR CTCCCCAGTGGAGGCCTCCT GGG (reversed) Intronic