ID: 1142899332

View in Genome Browser
Species Human (GRCh38)
Location 17:3002630-3002652
Sequence CTCCCCAGTGGAGGCCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 1, 2: 21, 3: 48, 4: 252}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142899332_1142899341 15 Left 1142899332 17:3002630-3002652 CCCAGGAGGCCTCCACTGGGGAG 0: 1
1: 1
2: 21
3: 48
4: 252
Right 1142899341 17:3002668-3002690 GAAGAGTATAAAGGAGGGACAGG 0: 1
1: 0
2: 2
3: 20
4: 361
1142899332_1142899344 21 Left 1142899332 17:3002630-3002652 CCCAGGAGGCCTCCACTGGGGAG 0: 1
1: 1
2: 21
3: 48
4: 252
Right 1142899344 17:3002674-3002696 TATAAAGGAGGGACAGGGTTGGG 0: 1
1: 0
2: 2
3: 23
4: 321
1142899332_1142899339 9 Left 1142899332 17:3002630-3002652 CCCAGGAGGCCTCCACTGGGGAG 0: 1
1: 1
2: 21
3: 48
4: 252
Right 1142899339 17:3002662-3002684 AAGAAAGAAGAGTATAAAGGAGG 0: 1
1: 0
2: 5
3: 113
4: 1198
1142899332_1142899338 6 Left 1142899332 17:3002630-3002652 CCCAGGAGGCCTCCACTGGGGAG 0: 1
1: 1
2: 21
3: 48
4: 252
Right 1142899338 17:3002659-3002681 CTGAAGAAAGAAGAGTATAAAGG 0: 1
1: 0
2: 5
3: 50
4: 579
1142899332_1142899342 16 Left 1142899332 17:3002630-3002652 CCCAGGAGGCCTCCACTGGGGAG 0: 1
1: 1
2: 21
3: 48
4: 252
Right 1142899342 17:3002669-3002691 AAGAGTATAAAGGAGGGACAGGG 0: 1
1: 0
2: 2
3: 24
4: 357
1142899332_1142899340 10 Left 1142899332 17:3002630-3002652 CCCAGGAGGCCTCCACTGGGGAG 0: 1
1: 1
2: 21
3: 48
4: 252
Right 1142899340 17:3002663-3002685 AGAAAGAAGAGTATAAAGGAGGG 0: 1
1: 0
2: 9
3: 191
4: 1934
1142899332_1142899343 20 Left 1142899332 17:3002630-3002652 CCCAGGAGGCCTCCACTGGGGAG 0: 1
1: 1
2: 21
3: 48
4: 252
Right 1142899343 17:3002673-3002695 GTATAAAGGAGGGACAGGGTTGG 0: 1
1: 0
2: 0
3: 22
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142899332 Original CRISPR CTCCCCAGTGGAGGCCTCCT GGG (reversed) Intronic
900391806 1:2436915-2436937 CCACCCAGCTGAGGCCTCCTGGG + Intronic
900436146 1:2632142-2632164 CTTCCCAGTGGGGCCTTCCTTGG + Intronic
900741165 1:4332211-4332233 CTCCCCAGGGGAGCCTTCCTGGG - Intergenic
900820757 1:4885937-4885959 CTCTTCAGTGCAGGCCTCTTTGG - Intergenic
901192503 1:7420970-7420992 CTTCTCAGGGGAGGCCTCCCTGG + Intronic
901237688 1:7676265-7676287 CTCCACAGTGGAGGTCACATAGG - Intronic
901870295 1:12134899-12134921 TGACCCAGTGGAAGCCTCCTGGG + Intronic
903236030 1:21951352-21951374 CTCCCCAGTGGAAGCCTAGTGGG + Intergenic
903543936 1:24111968-24111990 CTCCCCAGTGGCTGACTCTTAGG + Intronic
903857087 1:26343886-26343908 TTCCGGGGTGGAGGCCTCCTTGG + Exonic
904223891 1:28998169-28998191 CTCCCCAGAGGAGACTTCCCGGG - Intronic
904417220 1:30370693-30370715 GTCCCTTCTGGAGGCCTCCTGGG + Intergenic
904481711 1:30797994-30798016 CTCCCCAGTCCTGGCCTCCTGGG - Intergenic
904488778 1:30845199-30845221 TTCCCTAGTGGAGGCATCATGGG - Intergenic
904600001 1:31667990-31668012 CTCCCCACTGTAGGCCCCCTTGG - Intronic
904944528 1:34189619-34189641 TTCCCCAGTGGAGCCCACCCTGG - Intronic
905470471 1:38188051-38188073 CTCCCCAAGGCAGGGCTCCTAGG - Intergenic
908785338 1:67729764-67729786 CTCCCCAGTGGCAGCCTCCAAGG + Intronic
911040073 1:93584366-93584388 CAGCCCAGAGGAGGCATCCTAGG - Intronic
911898499 1:103470270-103470292 CTGCCCAGTGGAGGCCAGCCTGG + Intergenic
912634965 1:111283330-111283352 CTCTCCAGTGTAGCCCTCCCAGG - Intergenic
912638117 1:111318030-111318052 CTCTCCAGTGTAGCCCTCCCAGG - Exonic
915147041 1:153801448-153801470 CACCTCTGTGCAGGCCTCCTGGG + Intergenic
915169941 1:153970500-153970522 CTAGCCAGTGGGTGCCTCCTGGG - Intronic
915625084 1:157109516-157109538 CTTCCTAATGGAGTCCTCCTTGG - Intergenic
916501718 1:165393154-165393176 CTCCCCAGGGGAGGCATCTTGGG - Intergenic
916761547 1:167822048-167822070 TTCCACAGTGGACTCCTCCTGGG - Exonic
919757322 1:201074218-201074240 CTCCCCTGCGGAGGGATCCTGGG - Intronic
919939506 1:202276543-202276565 ATCCCCAGTGGGGTCCTGCTGGG + Intronic
922744185 1:228035121-228035143 CTCCCCTGGGAAGCCCTCCTGGG - Intronic
923412139 1:233721123-233721145 CTCACCTGTGGAGACCTCCGAGG + Intergenic
1062936849 10:1396580-1396602 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062936861 10:1396621-1396643 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062936872 10:1396662-1396684 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062936884 10:1396703-1396725 CTCCCGAGCGGAGGCTTCCTGGG + Intronic
1062936896 10:1396744-1396766 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062936908 10:1396785-1396807 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062936921 10:1396826-1396848 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062936932 10:1396867-1396889 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062936943 10:1396908-1396930 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062936955 10:1396949-1396971 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062936967 10:1396990-1397012 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062936979 10:1397031-1397053 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062936990 10:1397072-1397094 CTCCCGAGCGCAGGCTTCCTGGG + Intronic
1062937002 10:1397113-1397135 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937013 10:1397154-1397176 CTCCCGAGCGCAGGCTTCCTGGG + Intronic
1062937024 10:1397195-1397217 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937035 10:1397236-1397258 CTCCCGAGCGCAGGCTTCCTGGG + Intronic
1062937046 10:1397277-1397299 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062937057 10:1397318-1397340 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937069 10:1397359-1397381 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937081 10:1397400-1397422 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937092 10:1397441-1397463 CTCCCGAGCGCAGGCTTCCTGGG + Intronic
1062937104 10:1397482-1397504 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937117 10:1397523-1397545 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937128 10:1397564-1397586 CTCCCGAGCGCAGGCTTCCTGGG + Intronic
1062937140 10:1397605-1397627 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937150 10:1397646-1397668 CTCCCGAGCGCAGGCTTCCTGGG + Intronic
1062937162 10:1397687-1397709 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937175 10:1397728-1397750 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937187 10:1397769-1397791 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937198 10:1397810-1397832 CTCCCGAGCGCAGGCTTCCTGGG + Intronic
1062937210 10:1397851-1397873 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937223 10:1397892-1397914 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937235 10:1397933-1397955 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062937246 10:1397974-1397996 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062937258 10:1398015-1398037 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062937270 10:1398056-1398078 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062937283 10:1398097-1398119 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062937293 10:1398138-1398160 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062937304 10:1398179-1398201 GTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062937314 10:1398220-1398242 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062937325 10:1398261-1398283 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1063648436 10:7909080-7909102 CTCTCCCGTGGAGGCCTGCCAGG + Intronic
1065975165 10:30835521-30835543 CTCCCCTGTGGATTCCTCCGAGG - Intronic
1066654657 10:37686784-37686806 CTCCCCAGAGGTTGCATCCTGGG - Intergenic
1067038422 10:42935403-42935425 CTCCCTGGTGGAGGTCACCTAGG + Intergenic
1067294022 10:44964254-44964276 TACCCCAGAGGAGGCCCCCTAGG - Intronic
1067536301 10:47112831-47112853 CTCCCCAGTGGTGGATTCCCTGG + Intergenic
1068401549 10:56534163-56534185 CTCCCCAGTCAGGGCCACCTGGG - Intergenic
1069414451 10:68185412-68185434 TTCCCTAGTGGGGGCCTCCAGGG + Intronic
1069757623 10:70782780-70782802 GTCCCCACTGGAGGCCTGCTGGG + Intronic
1069901082 10:71707068-71707090 CCCACCTGTGCAGGCCTCCTGGG + Intronic
1070384020 10:75907819-75907841 CTCCCCACTGTAGGCTTCCCAGG + Intronic
1070932638 10:80272150-80272172 CTCCCCAGATGAGACTTCCTGGG + Exonic
1072317418 10:94216251-94216273 CTGCCCAGTTGAGATCTCCTCGG + Intronic
1073267615 10:102237463-102237485 TCCCCCATTGGAGGCCCCCTCGG - Intronic
1075263226 10:120980291-120980313 TTCCCCAGTTGGTGCCTCCTCGG - Intergenic
1076866627 10:133169566-133169588 CCCCGCAGCAGAGGCCTCCTGGG - Intronic
1076990594 11:271404-271426 CTCCCCAGTGAAGACCACCAGGG + Intergenic
1077386160 11:2270460-2270482 CTCCCCAGGGCACGCGTCCTAGG + Exonic
1078840216 11:15071076-15071098 CTCCCAAGTGAAGGCCGCCTTGG + Intronic
1079305363 11:19316915-19316937 CTCTACAGAGAAGGCCTCCTAGG - Intergenic
1080467668 11:32513048-32513070 CTCCCCACTGAACTCCTCCTTGG - Intergenic
1081623744 11:44634632-44634654 CACCCCAGACCAGGCCTCCTGGG - Intergenic
1081918798 11:46753453-46753475 TACTCCAGTGGAGGCCTCCCGGG + Exonic
1083266166 11:61547913-61547935 CTCCCCACTGAGGCCCTCCTGGG + Intronic
1084692533 11:70735356-70735378 CACACCTGTGGAGGCTTCCTGGG + Intronic
1084718930 11:70891754-70891776 CTCCCCTCTGAAGGTCTCCTGGG + Intronic
1085233047 11:74989185-74989207 CCCCACAGTTGAGTCCTCCTCGG - Intronic
1086946269 11:92846754-92846776 ATCCCAAGAGGAGGCCTTCTGGG + Intronic
1088930571 11:114347293-114347315 CTCCGCAGTTGAGGTTTCCTCGG + Intergenic
1089085583 11:115814499-115814521 CTCCGCAGTGTGTGCCTCCTGGG + Intergenic
1089177125 11:116557116-116557138 CCCAGCAGTGGAGGTCTCCTCGG + Intergenic
1089525452 11:119094192-119094214 CTCCCGAGTGACTGCCTCCTAGG - Exonic
1090211615 11:124924753-124924775 CTCCCCAGTGAAGGTGTCGTCGG + Exonic
1091208395 11:133835936-133835958 CTGCCCAGTGGATCCTTCCTGGG + Intergenic
1092231038 12:6775375-6775397 CTGCCAAGTGGACTCCTCCTGGG + Exonic
1092898938 12:13040526-13040548 CGATCCAGTGGAGGCCTCCGAGG + Intergenic
1093514557 12:19971314-19971336 TTTCCCAGAGGAGGCTTCCTTGG + Intergenic
1095260238 12:40089927-40089949 CACCCCAGTAGAGACCTTCTGGG + Intronic
1096472584 12:51888779-51888801 CTCCCCAGAGGAGGCCACCCAGG + Exonic
1097916038 12:65021417-65021439 CCCACCTGTGGAGGCCTGCTTGG + Intergenic
1102346830 12:112166144-112166166 CTCCTCCGAGGAGTCCTCCTGGG - Intronic
1102446258 12:113005121-113005143 CTCCCAAGTGGAAGGCTCCCAGG + Exonic
1103161154 12:118730432-118730454 TTCCCTAGTGGAGTCATCCTTGG - Intergenic
1104332620 12:127861690-127861712 CTGGCCAGTGGAGGACTCCAGGG + Intergenic
1104675141 12:130707345-130707367 CTCCCCATGGGAGGACTCCTGGG - Intronic
1105927150 13:25018522-25018544 CTCCCCTGGGATGGCCTCCTGGG + Intergenic
1107469584 13:40679765-40679787 TTCCCCTGTGCAGGCATCCTTGG - Intergenic
1108688977 13:52846006-52846028 CTCCCCGGAGGAGGCCGCCCGGG - Exonic
1112471872 13:99696618-99696640 TTCCCAAGTCTAGGCCTCCTAGG - Intronic
1114277398 14:21159144-21159166 CTCCCCAGTGGTGAGCTGCTGGG - Intergenic
1114277968 14:21165094-21165116 CTCCCCAGTGGTGAGCTGCTGGG + Intergenic
1115770576 14:36661537-36661559 TTCCCCGGAGGAGGTCTCCTCGG + Intronic
1120846371 14:89129489-89129511 CTGCCCTGTGGAGGCCTCTCAGG + Intronic
1122296962 14:100711247-100711269 CTTCCCAGTGGAGGTGACCTTGG - Intergenic
1122408352 14:101513468-101513490 CTCCCCAGTGAAAGCCTCTGAGG + Intergenic
1122793331 14:104193568-104193590 CTCCCCTGTGCACCCCTCCTGGG + Intergenic
1122925050 14:104895591-104895613 CTGCCCTGTGGAGGCCTCCTGGG + Exonic
1124579578 15:30941674-30941696 CTCCCCATAGCAGGCCTCCAGGG + Exonic
1125721605 15:41847664-41847686 CTCCCCAGCTGCCGCCTCCTCGG - Exonic
1127376430 15:58389188-58389210 CACCCCAGTGGCAGCGTCCTTGG + Intronic
1128729041 15:70008123-70008145 TTCCCCTCTGCAGGCCTCCTAGG - Intergenic
1130127859 15:81109068-81109090 CTCTCCAGTGAAGCTCTCCTGGG + Intronic
1131635451 15:94228868-94228890 CTGCTCAGTGGGAGCCTCCTTGG - Intergenic
1132205085 15:99980948-99980970 CTTCCCAGTGGACCCCTCGTAGG + Intronic
1132725105 16:1334998-1335020 CTCCCCAGTGCAGGCTGTCTAGG - Intronic
1134673717 16:16074621-16074643 CTAGCCAGTGGGGGCCCCCTTGG + Intronic
1134814457 16:17194463-17194485 ATTCCCAGTGGAGGCCTCAGAGG - Intronic
1136609607 16:31358150-31358172 CTCTCCGGTGGAGGCCTCTGGGG + Intronic
1136748950 16:32615952-32615974 CCCCCCAGTTCAGGCCTCCTGGG + Intergenic
1139292143 16:65868709-65868731 CTTCCCAGTGAATGCTTCCTTGG - Intergenic
1139340807 16:66266857-66266879 CTCTCCAGTGGTGGCCGCCAGGG - Intergenic
1139905756 16:70364670-70364692 CTCCCCAGGGCAGGCAACCTAGG - Intronic
1139919327 16:70449418-70449440 CACCTCCCTGGAGGCCTCCTAGG + Intergenic
1141131938 16:81443447-81443469 CTGCCCAGGAGATGCCTCCTTGG - Intergenic
1141480062 16:84300436-84300458 CTCCCCAGCTGGGGCTTCCTGGG + Intronic
1141646446 16:85370457-85370479 CTCCTCCCTGGAGCCCTCCTGGG - Intergenic
1142154945 16:88528615-88528637 CTCCACAGTGGAGGTGTCCCTGG + Intronic
1203051083 16_KI270728v1_random:875166-875188 CCCCCCAGTTCAGGCCTCCTGGG + Intergenic
1142719521 17:1766932-1766954 CTCTGCATTGGAGCCCTCCTCGG + Exonic
1142852171 17:2709545-2709567 CTGCCCAGGGGAGGGCTCCCTGG - Intronic
1142899332 17:3002630-3002652 CTCCCCAGTGGAGGCCTCCTGGG - Intronic
1143024458 17:3933338-3933360 CTGCCCAGTGCAGACCTTCTGGG + Intronic
1143616381 17:8052628-8052650 CTCCAGAATGGTGGCCTCCTTGG + Intergenic
1144945139 17:18965918-18965940 CTCCACAGTGGGGGGCACCTGGG - Intronic
1144953131 17:19004583-19004605 CTCCTCCGGGCAGGCCTCCTGGG - Intronic
1147143937 17:38474593-38474615 GACCCCAGTGGAGGTGTCCTGGG + Intronic
1147650356 17:42058485-42058507 CTCCCTGGTGGAGGCTCCCTGGG - Intronic
1148529391 17:48374849-48374871 GTCCCCAGTGGAGGCATCCAAGG + Intronic
1148922103 17:51046692-51046714 GGCCCCCGTGTAGGCCTCCTTGG - Intronic
1151564598 17:74890803-74890825 CTTCTCAGAGGAGGCGTCCTTGG + Intronic
1155232275 18:23785014-23785036 CATTCCATTGGAGGCCTCCTTGG - Intronic
1156345064 18:36249552-36249574 CACTCCAGAGGAGGCCTCATAGG + Intronic
1157338282 18:46756861-46756883 CTCCCCATTGGCCGCCACCTCGG - Exonic
1160446145 18:78928241-78928263 CTGCCCTGTGGAGGCTTCCCTGG - Intergenic
1160835867 19:1124206-1124228 CTCCCCAGTGGGCACCTCCCTGG + Intronic
1160862727 19:1244543-1244565 CTGCCCTCTGGTGGCCTCCTTGG - Exonic
1160888776 19:1365856-1365878 CTCCCCAGTCCTGGCCTCCCGGG - Intronic
1161284712 19:3463316-3463338 CCCCCCAGTGGCTGCGTCCTCGG - Intronic
1161690131 19:5727611-5727633 CTCCCCAGTGGAAACTTCCTAGG - Intronic
1161805850 19:6442491-6442513 CTCCCCAGGGGACTCCTCCTTGG + Intronic
1162384859 19:10354653-10354675 CTCCCAAGTGTGGGCCTGCTGGG - Intronic
1163374264 19:16920907-16920929 CTGGCTGGTGGAGGCCTCCTAGG + Intronic
1164577456 19:29413894-29413916 GCCCCCAGTGGATGCCTCCAGGG + Intergenic
1164917026 19:32060058-32060080 CTCTCCAGTGGATGCCGTCTGGG - Intergenic
1165230357 19:34382842-34382864 GACCTAAGTGGAGGCCTCCTGGG + Intronic
1165335307 19:35165798-35165820 CTTCCCAGTGGGGCCCTCCCTGG - Intronic
1166199385 19:41226479-41226501 CTCCTCAGTCGCGGCTTCCTAGG - Intronic
1167472663 19:49684302-49684324 CTCTCCCGGGGAGGCCTGCTGGG - Intronic
1167608565 19:50494886-50494908 CACCCCCACGGAGGCCTCCTGGG - Intergenic
926051917 2:9750738-9750760 CTCCTCAGAGCAGCCCTCCTTGG + Intergenic
926167579 2:10531118-10531140 CTCCCCACTGGTGGCCTCAGTGG + Intergenic
927682127 2:25146647-25146669 CTCCTCACTAGTGGCCTCCTGGG + Intronic
927957503 2:27217787-27217809 CGCCCCAGTGGAGGCTGCCTTGG - Intronic
927973671 2:27322150-27322172 TTTCCAAGTTGAGGCCTCCTGGG + Intronic
930024520 2:47021993-47022015 TCCCCAAGTAGAGGCCTCCTGGG - Intronic
930971148 2:57397365-57397387 CTACCCACTGCAGGTCTCCTCGG - Intergenic
932949857 2:76280338-76280360 CTCCCCAGTGGAGGCCTGATGGG - Intergenic
934979519 2:98828458-98828480 GTCCCCAGTGGCGAACTCCTAGG + Intronic
935098721 2:99971732-99971754 CTCCCCAATGGAGGGCTCGATGG - Intronic
935649694 2:105371746-105371768 GTCCCCAGTGGAAGCTTCCTTGG + Intronic
937238685 2:120446476-120446498 CTCCACAGCAGAGGCCTCCCAGG - Intergenic
937475275 2:122209553-122209575 TTCCCCAGTTGAGGCCACCTTGG + Intergenic
937873382 2:126802446-126802468 CGCCCCAGTGCGGGGCTCCTGGG - Intergenic
938219468 2:129553270-129553292 CTCCCCCGTGCAGCCTTCCTGGG + Intergenic
938685069 2:133730182-133730204 CTCCCCAGGGCAGGTCACCTGGG + Intergenic
938773600 2:134521827-134521849 CTCCCCAGTGCCTGCCTCCTAGG - Intronic
946140963 2:217690241-217690263 CTCCCCAGTCCAGGCCACCATGG + Intronic
947642259 2:231713748-231713770 CTCCCCAGTTAAGGCTTCTTGGG - Intergenic
947839330 2:233197674-233197696 CTCCTCAGATGGGGCCTCCTGGG + Intronic
948556368 2:238814034-238814056 CACCACTGTGGAGGCCTCCAGGG - Intergenic
948853588 2:240719947-240719969 CTGCCCACTGCAGGCCTCCCTGG + Intronic
1168797405 20:620713-620735 ATCCCCTCTGGAGGCCTCATAGG + Intergenic
1168851940 20:982989-983011 CTCCCCAGAGGAGGCCTCCTGGG - Intronic
1168892663 20:1305144-1305166 CTCCCCAGTGCCATCCTCCTTGG - Exonic
1169210078 20:3760852-3760874 CGGCCCATTGGAGGCTTCCTGGG - Intronic
1170469488 20:16654463-16654485 CTCTCCTGTGGAGGCTTCCTGGG + Intergenic
1172869480 20:38126813-38126835 CTTCACAAAGGAGGCCTCCTTGG + Intronic
1173002120 20:39111894-39111916 CTTTCCAGTGGAGGCTGCCTGGG + Intergenic
1173049294 20:39543630-39543652 GTGCCCAGAGAAGGCCTCCTAGG - Intergenic
1173589624 20:44214411-44214433 CTCCCCAGGGGGGTCTTCCTTGG + Intergenic
1174354599 20:49989564-49989586 CTCACCACTGGGGGCCTCTTGGG + Intergenic
1175337546 20:58206049-58206071 CTCCCACGTCGACGCCTCCTAGG + Intergenic
1175773243 20:61636795-61636817 CGCCCCTGTGGAGGCTTCCTGGG - Intronic
1176100394 20:63361880-63361902 CTCCCCTCTGGACGCCTCTTGGG - Intronic
1179885122 21:44310566-44310588 GTCCCCACTGGAGTCCTCCCAGG - Intronic
1180039060 21:45266489-45266511 CTCCCCACAGCAGGCTTCCTGGG + Intronic
1180953824 22:19732530-19732552 CTACCCAGTGAAGCCCTCCTGGG + Intergenic
1182335356 22:29580387-29580409 CACCCAACTGGTGGCCTCCTGGG - Intronic
1183147495 22:36007682-36007704 CTCCCCAGCGGTTGCCTCCTCGG - Intronic
1183328393 22:37206580-37206602 CTCCCCAGTGGAAGCCTCTTGGG + Exonic
1184080357 22:42214967-42214989 CTCCTCAGCGAAGGCCTTCTGGG - Exonic
1184449195 22:44572939-44572961 GTCACCAGTGGAGGCTGCCTTGG + Intergenic
949509088 3:4753013-4753035 CTCCCCAGAGAAGCCCTCCCTGG - Intronic
950518205 3:13480657-13480679 CGCCCCAGTGGCTGCCTCCGTGG - Intronic
950664512 3:14487142-14487164 CTCCCCAGCGGGGGCTCCCTGGG + Exonic
953020012 3:39107319-39107341 CTGCCCGGTGGGAGCCTCCTGGG - Intronic
953512326 3:43554786-43554808 CTGCACAGTGGAGGCCACATGGG - Intronic
954326140 3:49865189-49865211 CTCCCCAGTGGAGGAGTGCAGGG - Intronic
954581067 3:51703198-51703220 CTCCCCCGTGCAGGGCTCCCAGG - Intronic
956136877 3:66108009-66108031 CTCTGTAGTGGAGGGCTCCTGGG + Intergenic
956788155 3:72659980-72660002 CTCCCATGTGGAGGCCTAATGGG - Intergenic
956884277 3:73543236-73543258 CACCCCAGTGCTGGCCTCCAAGG - Intronic
957048786 3:75396187-75396209 CTCCCCTGGGATGGCCTCCTGGG + Intergenic
961438854 3:126938816-126938838 CTCAGCAGTGGTGGCCTCCTGGG - Intronic
961654038 3:128431971-128431993 CTCCTCAGTGAGGCCCTCCTTGG - Intergenic
962371225 3:134822317-134822339 CTCCCCAGCCTAGGCTTCCTGGG + Intronic
964317826 3:155462862-155462884 CTCCCCAGTGGATGCCTGGAGGG + Intronic
966910250 3:184555597-184555619 CTTCCCAAAGGAGGCCTCCTCGG - Intronic
968690097 4:1985946-1985968 CTTCCCAGGGGAGGCCACCAAGG + Intronic
969288333 4:6222210-6222232 CTCCCCAGTGAGGGCGTCCCTGG + Intergenic
969705233 4:8788177-8788199 CTCCCCAGGAGAGGGCTGCTGGG + Intergenic
975656395 4:76645343-76645365 ATCCCCAGAGGATGCCTCCTAGG + Intronic
978002348 4:103572054-103572076 CTCAGCAGTGGAAGACTCCTGGG + Intergenic
985527843 5:416054-416076 CTGCACACTGGATGCCTCCTTGG + Intronic
985630486 5:1011486-1011508 CTCCTCAGTGGATACCACCTGGG - Intronic
985655698 5:1130460-1130482 CACCCCAGGAGAGGCCACCTGGG + Intergenic
985678361 5:1243742-1243764 CTCACCAGTCAGGGCCTCCTTGG - Exonic
985767311 5:1786875-1786897 TTCCCCAGTGGGGGCCTGATTGG - Intergenic
988264118 5:28928076-28928098 CTCCCCTGGGATGGCCTCCTGGG + Intergenic
991002407 5:61795531-61795553 CTCCACAGGGAAGGCCCCCTGGG + Intergenic
992719468 5:79545918-79545940 CTCCTCAGTGAAGACCTTCTTGG + Intergenic
997956945 5:138286185-138286207 CTCCCCAGTGAATGGCCCCTGGG - Intronic
998134328 5:139666780-139666802 CTGCCCAGTGGAGGCAGGCTGGG + Intronic
998817061 5:146025389-146025411 GCCCCCAGTCCAGGCCTCCTTGG + Intronic
999768011 5:154755512-154755534 CTCTGCAGTCCAGGCCTCCTAGG - Intronic
1000195768 5:158956188-158956210 CTCCAAAGTAGAAGCCTCCTTGG - Intronic
1001151162 5:169228299-169228321 CTCCCCTGGGGAGGCCTTTTTGG - Intronic
1002313299 5:178327768-178327790 CTCCCCTCTGAAGGCCTCCTGGG + Intronic
1004042368 6:11993392-11993414 CTTCCTAGTGGAGCCCTCATTGG - Intergenic
1004217037 6:13712133-13712155 CTCCCCACCGTAGGGCTCCTCGG + Intergenic
1008533733 6:52490320-52490342 CGTCCCAGTGGATGACTCCTTGG + Exonic
1013803398 6:113971191-113971213 CTCCCCCGTGGAGGCCGCAGTGG - Exonic
1016197451 6:141362514-141362536 CTTCCCAGTGGTGACTTCCTGGG - Intergenic
1016995945 6:149962657-149962679 CTTCCCAGTGGCCTCCTCCTAGG + Intergenic
1018838174 6:167500770-167500792 CTCCTCTGGGAAGGCCTCCTGGG - Intergenic
1019534378 7:1520988-1521010 CTCCCGGGTGGTGGACTCCTGGG + Intergenic
1019685325 7:2378895-2378917 TTCCCCAGTGCATCCCTCCTGGG - Intronic
1019926509 7:4196591-4196613 CTGGCCAGGGGAGCCCTCCTAGG + Intronic
1020109858 7:5441907-5441929 CTCCCCAGAGAAGCCCTCCCTGG + Intronic
1023967550 7:44970782-44970804 CTCCCCCATGAAGGCCTCCTGGG + Intronic
1024256896 7:47546078-47546100 CACCTCAGTCCAGGCCTCCTGGG - Intronic
1024733479 7:52277633-52277655 CTACCCAGTGGACGCCAGCTAGG + Intergenic
1026829687 7:73603155-73603177 CTCCCCAGTGGGAGGCTCTTGGG + Intronic
1029703761 7:102264682-102264704 AGCCCCAGTTGTGGCCTCCTGGG - Intronic
1031142267 7:117956383-117956405 ATCCCCACTGGGGGTCTCCTGGG - Intergenic
1033768330 7:144520083-144520105 CTCCACAGTTGAGGTCTCTTCGG + Intronic
1034416923 7:150970220-150970242 CTCCCCAGAGGTGGCTTCCTGGG - Intronic
1034931606 7:155167873-155167895 CACCCCTGGGGAGGCCACCTGGG - Intergenic
1035045826 7:155964733-155964755 CTCCCCAGTGGTGGCTTCCCAGG + Exonic
1035398193 7:158548769-158548791 CTCCCCTCTAGAGGCCGCCTGGG - Intronic
1037480327 8:19299111-19299133 CTCCCCAGAATAGACCTCCTTGG - Intergenic
1037917317 8:22780578-22780600 CCCACCAGAGGATGCCTCCTGGG + Intronic
1038034967 8:23679781-23679803 CTGTCCAGTGGAGGGCTCATGGG - Exonic
1039147134 8:34460808-34460830 CTCCCCAGTTGGGTTCTCCTGGG - Intergenic
1039568788 8:38570085-38570107 CTTCCCAGTGGGGGCTGCCTGGG + Intergenic
1044927816 8:97224199-97224221 CTCCCCTGTGGTGGCACCCTGGG + Intergenic
1045270542 8:100657550-100657572 CTCCCCAAATGAGGTCTCCTTGG - Intronic
1048031859 8:130640713-130640735 CTCTGGAGTGGAGGCCTCTTGGG + Intergenic
1048266919 8:132995473-132995495 CACCCCAAAGGAGGCCTCCATGG + Intronic
1049203109 8:141351387-141351409 TTCCTCATTGGAGCCCTCCTGGG + Intergenic
1049251779 8:141593146-141593168 CTCCCGAGAGGAGGTCGCCTTGG - Intergenic
1049748619 8:144273389-144273411 GACTCCAGTGGAGGCCTCGTGGG + Intronic
1050327120 9:4508506-4508528 CTCACCTGGGGATGCCTCCTGGG - Intronic
1056095431 9:83248445-83248467 CTCCCCAGTGAAGGCAGCCCGGG - Exonic
1056752926 9:89364809-89364831 CTCCCCAGGCGAGGCAGCCTGGG - Intronic
1056869910 9:90267868-90267890 CTCTCCTGAGGAGGACTCCTGGG - Intergenic
1058080697 9:100698570-100698592 AGCCTCAGTGGAGGCCTCCATGG + Intergenic
1058670183 9:107354718-107354740 CTCCCCAGTGGGGGACTGCTTGG + Intergenic
1059637750 9:116187382-116187404 TTCCCCAGAGGTGGCCACCTGGG - Exonic
1059801058 9:117749993-117750015 CTCCCCAGTGCAGCCTTCCAGGG + Intergenic
1060915958 9:127390824-127390846 ATCCCCAGAAGGGGCCTCCTGGG - Intronic
1061087443 9:128407425-128407447 ACCTCCAGCGGAGGCCTCCTAGG - Intergenic
1061516105 9:131091437-131091459 CTCCCCAGCTCAGGCCTCCCAGG - Intronic
1062001536 9:134218355-134218377 CTCCATGGTAGAGGCCTCCTTGG + Intergenic
1062049388 9:134439265-134439287 CTTCCCAGTGGCTGCTTCCTGGG + Intronic
1062273392 9:135719847-135719869 GGCCCCAGTGCAGGCCTCCCGGG + Intronic
1062314949 9:135962344-135962366 CTCCCCACTGCAAGCCCCCTTGG + Intergenic
1062442750 9:136578476-136578498 TTCCCCAGCGCAGGGCTCCTGGG - Intergenic
1062581841 9:137232274-137232296 CTCCCCAGAGGGGGCCTGCATGG - Intronic
1062623682 9:137433716-137433738 TTCCTCAGAGGGGGCCTCCTGGG - Intronic
1062634869 9:137485477-137485499 CTCTCCAGGTGAGGCCTCATCGG + Intronic
1062636867 9:137496069-137496091 GTCCCCAGGGGAGGGCACCTAGG + Intronic
1203746183 Un_GL000218v1:41710-41732 GTCCCCAGTGGGGCCCTCCCTGG - Intergenic
1185576117 X:1173660-1173682 CTCCTCACTGGAGGCCACATGGG + Intergenic
1188451210 X:30309389-30309411 CTGCCCAGTGGCTGCCTCCTGGG + Exonic
1189168448 X:38885313-38885335 TTCTCCAGTTGTGGCCTCCTGGG + Intergenic
1192203402 X:69081318-69081340 CTCCCCCAGGGAAGCCTCCTGGG + Intergenic
1196866439 X:120075464-120075486 CTTCCATGTGGAGGCATCCTGGG - Intronic
1196876659 X:120160817-120160839 CTTCCATGTGGAGGCATCCTGGG + Intronic
1198312420 X:135435487-135435509 CTCCCCAGTCAGGGTCTCCTTGG - Intergenic