ID: 1142899602

View in Genome Browser
Species Human (GRCh38)
Location 17:3003961-3003983
Sequence GTCTGTGCCGACCGTGTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 27}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142899602_1142899612 12 Left 1142899602 17:3003961-3003983 CCACTTACACGGTCGGCACAGAC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1142899612 17:3003996-3004018 GGCTGGAGGAGGAGGGGGAGTGG 0: 1
1: 5
2: 78
3: 684
4: 4818
1142899602_1142899605 -2 Left 1142899602 17:3003961-3003983 CCACTTACACGGTCGGCACAGAC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1142899605 17:3003982-3004004 ACCACTCTAATGCAGGCTGGAGG 0: 1
1: 0
2: 3
3: 18
4: 320
1142899602_1142899613 13 Left 1142899602 17:3003961-3003983 CCACTTACACGGTCGGCACAGAC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1142899613 17:3003997-3004019 GCTGGAGGAGGAGGGGGAGTGGG 0: 1
1: 2
2: 62
3: 709
4: 6931
1142899602_1142899603 -9 Left 1142899602 17:3003961-3003983 CCACTTACACGGTCGGCACAGAC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1142899603 17:3003975-3003997 GGCACAGACCACTCTAATGCAGG 0: 1
1: 0
2: 0
3: 5
4: 69
1142899602_1142899616 18 Left 1142899602 17:3003961-3003983 CCACTTACACGGTCGGCACAGAC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1142899616 17:3004002-3004024 AGGAGGAGGGGGAGTGGGGTGGG 0: 1
1: 2
2: 41
3: 429
4: 3863
1142899602_1142899618 23 Left 1142899602 17:3003961-3003983 CCACTTACACGGTCGGCACAGAC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1142899618 17:3004007-3004029 GAGGGGGAGTGGGGTGGGAAGGG 0: 1
1: 1
2: 29
3: 336
4: 3241
1142899602_1142899614 14 Left 1142899602 17:3003961-3003983 CCACTTACACGGTCGGCACAGAC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1142899614 17:3003998-3004020 CTGGAGGAGGAGGGGGAGTGGGG 0: 1
1: 4
2: 28
3: 274
4: 2140
1142899602_1142899617 22 Left 1142899602 17:3003961-3003983 CCACTTACACGGTCGGCACAGAC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1142899617 17:3004006-3004028 GGAGGGGGAGTGGGGTGGGAAGG 0: 1
1: 4
2: 57
3: 739
4: 4881
1142899602_1142899610 6 Left 1142899602 17:3003961-3003983 CCACTTACACGGTCGGCACAGAC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1142899610 17:3003990-3004012 AATGCAGGCTGGAGGAGGAGGGG 0: 1
1: 0
2: 9
3: 75
4: 695
1142899602_1142899609 5 Left 1142899602 17:3003961-3003983 CCACTTACACGGTCGGCACAGAC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1142899609 17:3003989-3004011 TAATGCAGGCTGGAGGAGGAGGG 0: 1
1: 0
2: 3
3: 41
4: 427
1142899602_1142899608 4 Left 1142899602 17:3003961-3003983 CCACTTACACGGTCGGCACAGAC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1142899608 17:3003988-3004010 CTAATGCAGGCTGGAGGAGGAGG 0: 1
1: 0
2: 3
3: 44
4: 483
1142899602_1142899615 17 Left 1142899602 17:3003961-3003983 CCACTTACACGGTCGGCACAGAC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1142899615 17:3004001-3004023 GAGGAGGAGGGGGAGTGGGGTGG 0: 2
1: 12
2: 155
3: 1600
4: 8406
1142899602_1142899611 7 Left 1142899602 17:3003961-3003983 CCACTTACACGGTCGGCACAGAC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1142899611 17:3003991-3004013 ATGCAGGCTGGAGGAGGAGGGGG 0: 1
1: 2
2: 19
3: 154
4: 1249
1142899602_1142899607 1 Left 1142899602 17:3003961-3003983 CCACTTACACGGTCGGCACAGAC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1142899607 17:3003985-3004007 ACTCTAATGCAGGCTGGAGGAGG 0: 1
1: 0
2: 1
3: 16
4: 198
1142899602_1142899604 -5 Left 1142899602 17:3003961-3003983 CCACTTACACGGTCGGCACAGAC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1142899604 17:3003979-3004001 CAGACCACTCTAATGCAGGCTGG 0: 1
1: 0
2: 1
3: 13
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142899602 Original CRISPR GTCTGTGCCGACCGTGTAAG TGG (reversed) Intronic