ID: 1142899921

View in Genome Browser
Species Human (GRCh38)
Location 17:3005427-3005449
Sequence GTGTCCTACCTTCTGGAAAA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142899921_1142899927 13 Left 1142899921 17:3005427-3005449 CCGTTTTCCAGAAGGTAGGACAC 0: 1
1: 0
2: 2
3: 9
4: 185
Right 1142899927 17:3005463-3005485 CCTCTCGCATCCACGATGCCAGG 0: 1
1: 0
2: 0
3: 0
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142899921 Original CRISPR GTGTCCTACCTTCTGGAAAA CGG (reversed) Exonic
901240423 1:7689828-7689850 GTGTCCTAGCTTCTGGGGCATGG - Intronic
901870001 1:12132947-12132969 CTGTCCTCCCAGCTGGAAAATGG - Intronic
904944101 1:34186709-34186731 GTGTCCTTCCCTCTGGCCAATGG - Intronic
907548720 1:55286037-55286059 GTGTCCTGCTTACCGGAAAAGGG + Intergenic
908735278 1:67270081-67270103 TTGTCCTACTTTCTGGGACAGGG + Intergenic
908872609 1:68631098-68631120 CTTTCCTACCCTCTGAAAAAGGG - Intergenic
913469217 1:119172950-119172972 GTGTCCGGCTTTCTGGGAAAGGG + Intergenic
915961626 1:160271866-160271888 TTGTCCTACCTTGAGGAAAGGGG + Intergenic
916687490 1:167160584-167160606 CTGTCTTTCCTTCTGCAAAAAGG + Intergenic
917716438 1:177742732-177742754 GTGTCCTAGTTTCAGGAGAAAGG - Intergenic
918423346 1:184386185-184386207 ATTTCCCACCCTCTGGAAAAGGG - Intergenic
920364261 1:205439900-205439922 GCTTCCTACCTCCTGGAAATGGG + Intronic
920580045 1:207097952-207097974 CTCTCCTACCTCCAGGAAAATGG + Intronic
921795067 1:219333255-219333277 GTGTCCTAGTTCCTGGAATATGG - Intergenic
923193102 1:231639664-231639686 GTGTCCTCCCTTGTGAAAATGGG + Intronic
923742071 1:236664152-236664174 TGGTCCTACCATCTGGAAAGAGG + Intergenic
1063102221 10:2960535-2960557 GTGTCAATTCTTCTGGAAAAAGG - Intergenic
1064445453 10:15388846-15388868 GTTTCCTCATTTCTGGAAAATGG + Intergenic
1064977329 10:21131908-21131930 GCTTCCTACTTTCTGCAAAAAGG + Intronic
1066655099 10:37690942-37690964 CTGTTCTATTTTCTGGAAAAGGG - Intergenic
1069262266 10:66413722-66413744 ATGTCTAACCTTCTGGATAATGG - Intronic
1069651952 10:70055091-70055113 GTGTCCCACCCACTGGGAAATGG - Intronic
1070009962 10:72463475-72463497 GTTTCATACCTTTTGGAGAATGG - Intronic
1070533244 10:77355825-77355847 GTGGCCATCCTTCTGGTAAAAGG + Intronic
1073291944 10:102417452-102417474 GTACCCCACCCTCTGGAAAAGGG + Intronic
1074551170 10:114443826-114443848 GTTTCCTTTCTTCTGGAAATGGG - Intronic
1074612751 10:115037690-115037712 GTGTCAGACTTTCTGGGAAAGGG + Intergenic
1074742895 10:116501693-116501715 GTGTCAGACTTTCTGGGAAAGGG - Intergenic
1076992189 11:281259-281281 CTGTCCTACCTGCTGGAGGACGG + Exonic
1077283713 11:1756769-1756791 GGGCCCTTCCTTCTGGGAAAAGG - Intronic
1078396740 11:10988178-10988200 GATTCCCACCTTTTGGAAAAGGG + Intergenic
1079420100 11:20277730-20277752 GTGCCCTATTTTCTAGAAAATGG - Intergenic
1079637395 11:22760935-22760957 GCTTCCTATCTTCCGGAAAATGG + Intronic
1080307390 11:30851368-30851390 ATGTCCCACCTTGGGGAAAAGGG + Intronic
1080856329 11:36114911-36114933 GTGTCCCTACTTCTGGAAACTGG + Intronic
1082161131 11:48888947-48888969 ATTTCCTTCCTTCAGGAAAATGG - Intergenic
1082166828 11:48959909-48959931 ATTTCCTTCCTTCAGGAAAATGG + Intergenic
1082189114 11:49220946-49220968 ATGTCATACCTTCAGTAAAAAGG + Intergenic
1082236755 11:49826721-49826743 ATTTCCTTCCTTCAGGAAAATGG - Intergenic
1082240201 11:49861216-49861238 ATTTCCTTCCTTCAGGAAAATGG - Intergenic
1082241945 11:49882980-49883002 ATTTCCTTCCTTCAGGAAAATGG + Intergenic
1082656444 11:55863916-55863938 ATTTCCTTCCTTCAGGAAAATGG + Intergenic
1082807175 11:57458685-57458707 CTGTCCTGCCTCCTGGAAATAGG + Intergenic
1082946626 11:58768320-58768342 GTGTCCCACATTCTGGGAGATGG + Intergenic
1086677411 11:89625742-89625764 ATGTCATACCTTCAGTAAAAAGG - Intergenic
1087195576 11:95301332-95301354 TTGTCTTACCTCTTGGAAAAGGG - Intergenic
1087798664 11:102480835-102480857 GTGGCCTGCCATCTGGAGAAAGG - Intronic
1088939310 11:114437587-114437609 GTGGCCTACTTTATGAAAAATGG - Intronic
1090995076 11:131858730-131858752 GAATCCTCCCTTCTGGAATAGGG + Intronic
1091142557 11:133248320-133248342 GTGTCCCACCTTCTGCTCAAAGG - Intronic
1091532593 12:1374079-1374101 GTGTACTAACTTTTGGACAAGGG + Intronic
1094671535 12:32574855-32574877 TTTTCTTACCTTCTGGAAGAAGG - Intronic
1095334820 12:41011915-41011937 CTGTCCTTCCTTCAGGAAAATGG - Intronic
1097107057 12:56632190-56632212 GTTTCCTTCCTTCTGGAGAAAGG + Intronic
1099997690 12:89796775-89796797 GGGTCCAACATTCTGGAGAAGGG - Intergenic
1107802349 13:44120559-44120581 ATATCCTACTTTATGGAAAATGG - Intergenic
1112627317 13:101120408-101120430 GTGACCTACTGTCTGGAGAAAGG - Intronic
1113362251 13:109642416-109642438 GTCTGCTTCCTTCTGCAAAAAGG - Intergenic
1113393577 13:109921142-109921164 GTGTCTTACCGTCAGGAAATGGG + Intergenic
1113839483 13:113350683-113350705 CTGTCCTCCCTGCTGGGAAATGG + Intronic
1114648877 14:24270828-24270850 GGGCCCCACCTTCTGGAATACGG + Exonic
1118325893 14:64780130-64780152 CTGTCCTACCCACTGCAAAAGGG + Intronic
1120332034 14:83105438-83105460 ATGTCCTACCATCTGCAATATGG - Intergenic
1121526194 14:94621108-94621130 GTGTCCGGCCTTCTGGACAGTGG - Intronic
1128108689 15:65062641-65062663 CTGTGCTACCTGCTGGAAATGGG + Intronic
1128923478 15:71633019-71633041 ATGTCCTGCCTCCTGAAAAAAGG - Intronic
1129059214 15:72847494-72847516 GTGTCCTTCCTTCTGAAGCAAGG + Intergenic
1129076541 15:73001783-73001805 GTGTACAGCCCTCTGGAAAAAGG - Intergenic
1131310609 15:91287098-91287120 CTCTCCTAGCTTTTGGAAAAAGG + Intronic
1133937672 16:10282283-10282305 GTGACCTGCCTTGGGGAAAAGGG - Intergenic
1135224422 16:20643186-20643208 GTGTCAGGCTTTCTGGAAAAGGG - Intronic
1135756435 16:25102351-25102373 GTTTCCAACCTTTTGGAATATGG + Intergenic
1138575614 16:57905521-57905543 GTGTCCTACTGTGTGGTAAAAGG + Intronic
1142899921 17:3005427-3005449 GTGTCCTACCTTCTGGAAAACGG - Exonic
1144621545 17:16821610-16821632 GTGTCCTACCTTCCAGCACAGGG - Intergenic
1144884874 17:18451103-18451125 GTGTCCTACCTTCCAGCACAGGG + Intergenic
1145147351 17:20493274-20493296 GTGTCCTACCTTCCAGCACAGGG - Intergenic
1145882405 17:28361848-28361870 CTGTCTTATCTTCTGGAAAAGGG - Exonic
1149223287 17:54439850-54439872 GTGTCAGACTTTCTGGGAAAGGG + Intergenic
1152644686 17:81463333-81463355 GTGTCATATGGTCTGGAAAATGG - Intronic
1156127700 18:33927004-33927026 TGGTTCTAACTTCTGGAAAAAGG - Intronic
1157225082 18:45855421-45855443 GTGCCCTACTTACGGGAAAATGG - Intronic
1158341750 18:56473582-56473604 ATGTCCTCCCTGCTGGGAAATGG - Intergenic
1159142762 18:64417877-64417899 ATGTCCTCCCTTGTGAAAAAGGG + Intergenic
1160601028 18:80012868-80012890 GTGCCCTTCCTCCTGGGAAACGG + Intronic
1161026211 19:2038539-2038561 GTCTGCCACCTTCAGGAAAACGG - Exonic
1163604507 19:18266629-18266651 TGGTCATACCTTCTGGACAATGG + Exonic
925261801 2:2535805-2535827 GAGTCCTCCGGTCTGGAAAATGG + Intergenic
925638743 2:5967498-5967520 GTGTCCTACACTCTGGAAAATGG - Intergenic
925950178 2:8902159-8902181 GTGTCAGGCTTTCTGGAAAAGGG - Intronic
926756938 2:16244019-16244041 GTGTGCTTCATTTTGGAAAAGGG + Intergenic
928779835 2:34805408-34805430 GGTTCTTACCTTCTAGAAAAGGG + Intergenic
929650529 2:43676319-43676341 CTGTCCTAACGCCTGGAAAATGG - Intronic
931397334 2:61899247-61899269 GTTGCCTTCCTTCTGGTAAAGGG - Intronic
933122622 2:78560242-78560264 CTGACTTACTTTCTGGAAAATGG - Intergenic
934589750 2:95536490-95536512 ATTTCCTTCCTTCAGGAAAATGG - Intergenic
935307733 2:101753928-101753950 CTGTCCACCCTTCTGGACAAGGG - Intronic
942505139 2:176633982-176634004 ATGACCTACATTCAGGAAAATGG + Intergenic
942600482 2:177635758-177635780 GTGTACTACCATTTGTAAAAAGG - Intronic
942746496 2:179240316-179240338 GTGTTCTACTTCCTGGAAGATGG + Intronic
943564157 2:189497659-189497681 ATTTCCAACCTTCTGGTAAATGG - Intergenic
946442813 2:219711199-219711221 CTTTCCTAGCTTCTGGAAAAAGG + Intergenic
946655644 2:221943476-221943498 CTGACCTTCCTTTTGGAAAATGG - Intergenic
947531478 2:230911454-230911476 GTGTCCAACCATCAGGAAAGTGG - Intronic
947918860 2:233852818-233852840 CTCTCCTACCTACTAGAAAACGG + Intronic
1170494753 20:16914380-16914402 GTGTCCTAACTCCTAGAACAAGG + Intergenic
1171319958 20:24233806-24233828 GTCTCCTACCTTGTGAAACAGGG + Intergenic
1172071517 20:32260772-32260794 CTGGCCTAACCTCTGGAAAATGG + Intergenic
1173458347 20:43221936-43221958 GTGTCCTTCCTGCTGGATTATGG - Intergenic
1176268224 20:64221753-64221775 GTCTCCTATCTTCTGGATAAGGG - Intronic
1176312046 21:5156666-5156688 CTCTCTTACCTTCTGGAAGAGGG - Intergenic
1177204438 21:17995002-17995024 GTGCCCTACATCCTGGAGAATGG - Intronic
1179845002 21:44105364-44105386 CTCTCTTACCTTCTGGAAGAGGG + Exonic
1180550041 22:16531141-16531163 GTTTCCTACATTCTGAAAATGGG - Intergenic
1182006111 22:26960995-26961017 GTGTCACACCTTATGGAAAGGGG + Intergenic
1182213551 22:28696971-28696993 GTGTAGTACCTTCATGAAAACGG - Exonic
1184884587 22:47334854-47334876 GGCACCTACCTCCTGGAAAAGGG + Intergenic
950686259 3:14620648-14620670 GTGTCCTAGCAACTGGAAAAGGG - Intergenic
951092553 3:18591494-18591516 ATGTCATACTTTCTGGAAAAAGG - Intergenic
952046459 3:29327069-29327091 GTCTCCTACCTTTTTTAAAAAGG - Intronic
952263547 3:31763982-31764004 GTGTTCTCTCTTCTGTAAAATGG - Intronic
954357158 3:50091591-50091613 GTATCATGCCTACTGGAAAATGG - Intronic
955378016 3:58414199-58414221 ATATCCTATCTTCTAGAAAATGG - Intronic
956106462 3:65823941-65823963 ATGTCCTACCATCTGGTAAGTGG - Intronic
957562713 3:81844062-81844084 GTTTCCTAACTGCTGGAAAAGGG + Intergenic
958681929 3:97342464-97342486 TTGTATGACCTTCTGGAAAAGGG - Intronic
961261381 3:125604982-125605004 GTGTCAGACTTTCTGGGAAAGGG + Intergenic
964540629 3:157775399-157775421 CTGTCCTGCCTTCAGGAATAAGG + Intergenic
966088885 3:176106216-176106238 CTGTTCTTCATTCTGGAAAAGGG + Intergenic
966182531 3:177199667-177199689 GTCTCCTCCCTTGTGGAATAAGG - Intergenic
967853822 3:194101558-194101580 GTGGCCAACTTTCTGAAAAATGG - Intergenic
970011012 4:11459460-11459482 GTGGGCTCCCTTCTGGAACAGGG - Intergenic
971069781 4:23078751-23078773 GAGTCCTATCTTCATGAAAATGG + Intergenic
971867765 4:32195020-32195042 GTATTCTACCTTGGGGAAAAAGG - Intergenic
971989646 4:33875637-33875659 GAGTTCTTCATTCTGGAAAAAGG - Intergenic
976374977 4:84335672-84335694 AAATCCTACCATCTGGAAAAAGG - Intergenic
977883807 4:102235950-102235972 GTGTCAGGCTTTCTGGAAAAGGG + Intergenic
978969157 4:114781386-114781408 GTGTCCTATCTTGTGTAAAGTGG - Intergenic
980779605 4:137479479-137479501 GTGCCCTACCTTCGAGACAAGGG - Intergenic
984922500 4:184778140-184778162 CTGCCCTACCTACTGGACAAAGG + Intronic
985691865 5:1317796-1317818 ATGTATTACTTTCTGGAAAAGGG + Exonic
990901016 5:60749003-60749025 GTGTCCTCTCCTCTTGAAAATGG + Intergenic
992896686 5:81252014-81252036 CTCTACCACCTTCTGGAAAAAGG + Intronic
993431813 5:87841481-87841503 GTGTCCTACACCCTGGGAAAAGG - Intergenic
996919340 5:128749456-128749478 GTTGCCTGCTTTCTGGAAAATGG + Intronic
998786086 5:145710415-145710437 ATTTCCTACCTTTTTGAAAAAGG - Intronic
999128384 5:149264005-149264027 CTGTTCTACCTGATGGAAAAGGG + Intergenic
1000909827 5:167008501-167008523 GTGTCCTGCATTTTGGTAAATGG - Intergenic
1001464960 5:171955900-171955922 GGTTCCTACCTTGTTGAAAATGG - Intronic
1003989807 6:11474416-11474438 CTTTCCTACCTCCAGGAAAAAGG - Intergenic
1005162131 6:22876237-22876259 GTGACCTACCTTATGGAAAAGGG - Intergenic
1005436015 6:25813086-25813108 GTGTTCTACCTGCTGGACCAGGG + Exonic
1005836274 6:29711819-29711841 GGGTCCTTCCTCCTGGAATAGGG - Intergenic
1006197070 6:32250924-32250946 GCTTCCTACCTCCAGGAAAAGGG + Intergenic
1008744185 6:54648647-54648669 ATGTCCTACCTTCTTGATGAAGG - Intergenic
1009320742 6:62285849-62285871 AAGTCCTACCTTCTGCCAAAAGG + Exonic
1010927199 6:81757016-81757038 GCTTCCTACCTTCTCAAAAATGG + Intergenic
1011717536 6:90123033-90123055 GTGTCCTAACTTCTAGAACCTGG + Intronic
1011759363 6:90544306-90544328 GTGTTCTCCCTTCTCCAAAAAGG + Intronic
1013970003 6:116005536-116005558 ATTTTCTACCTTCTGGGAAATGG - Intronic
1014288832 6:119535116-119535138 TTAACCTACCTTCTGGAGAATGG + Intergenic
1014625023 6:123714516-123714538 ATGACCCACCTTCTGGAAGAGGG - Intergenic
1016271175 6:142292441-142292463 ATGTCCTACCTGGTGGAGAAGGG - Intergenic
1018159551 6:161025109-161025131 GTGTCCCACCTTCGGCCAAATGG + Intronic
1019523654 7:1471333-1471355 GCGTCCTGCCTTCTGGATAGGGG - Intronic
1020001759 7:4760062-4760084 GTGTCCTTCCTTGTTGAACAGGG + Intronic
1020507068 7:9004231-9004253 GTGTCCTTCCTTGTGGTAAGGGG - Intergenic
1021433084 7:20583779-20583801 GTGTGCTACCTTCTGGGATTTGG + Intergenic
1022283939 7:28937545-28937567 GTTAGCTATCTTCTGGAAAAAGG - Intergenic
1024275112 7:47671196-47671218 GTGTCCTCTCTTCTACAAAATGG + Intergenic
1027854253 7:83488632-83488654 CTCTCCTAGCTTCTGGAAGAAGG - Intronic
1030734541 7:113030862-113030884 GTGTCATCCTTTCTGGAAAAGGG + Intergenic
1031453807 7:121955136-121955158 GTTTCCTACCTTTGGTAAAAGGG - Intronic
1034865828 7:154641036-154641058 TTGTCCTTCCTTTTGGCAAATGG + Intronic
1039019325 8:33187661-33187683 CTGCCCTACCTCCTGGAAACTGG - Intergenic
1039686373 8:39806433-39806455 GTGTCATACTTTGTTGAAAACGG - Intronic
1041329622 8:56710660-56710682 CTTTCCTGCTTTCTGGAAAAGGG + Intergenic
1042522104 8:69724528-69724550 AAGTTCTACCTTCTGGACAATGG + Intronic
1044079384 8:87865064-87865086 GTGTACTGCATTCTGGAAGATGG - Intergenic
1046349873 8:112993810-112993832 TTGACCTTCTTTCTGGAAAAAGG - Intronic
1047171576 8:122498238-122498260 GTGTCCTCCCCTCTGGAGCATGG + Intergenic
1047557925 8:125953078-125953100 GTGTTCTATCTTCAGCAAAAAGG + Intergenic
1055025374 9:71714041-71714063 CTGTACTATTTTCTGGAAAAAGG - Intronic
1055466527 9:76571840-76571862 GTGCCCTTCCTCCTGGGAAACGG + Intergenic
1056317181 9:85401229-85401251 GTTTGCTACCTTTTGGAGAAAGG + Intergenic
1058179771 9:101782861-101782883 GTGTTTCACCTTCAGGAAAAGGG - Intergenic
1058477927 9:105359203-105359225 CTGTACTACTTTATGGAAAAAGG - Intronic
1061359031 9:130129274-130129296 GGGTCCTATTTTCTGGGAAAGGG + Intronic
1062014350 9:134283795-134283817 GTGTCCTGCCTCCTGGGACAGGG - Intergenic
1062083020 9:134634358-134634380 TTGTCCCACATTCAGGAAAAGGG + Intergenic
1187028414 X:15459718-15459740 GTATCCTACCTCCTGGAAGGGGG - Exonic
1187092657 X:16113528-16113550 GTGTCCTAGTTTCTGAGAAAGGG + Intergenic
1187269681 X:17768567-17768589 GTTGCCCAGCTTCTGGAAAATGG + Intergenic
1190825677 X:54016023-54016045 GTGTCCTAAGGTCTTGAAAAAGG + Intronic
1191652875 X:63560729-63560751 GCTTCCTTCCCTCTGGAAAAAGG + Intergenic
1193463442 X:81817856-81817878 GTGACATACATTGTGGAAAAGGG - Intergenic
1201429387 Y:13889587-13889609 GTGTCATGCTTTCTGGGAAAGGG + Intergenic