ID: 1142900829

View in Genome Browser
Species Human (GRCh38)
Location 17:3010532-3010554
Sequence CCTCCTCCATTGGGCACCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 112}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142900829_1142900840 27 Left 1142900829 17:3010532-3010554 CCCATGGTGCCCAATGGAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1142900840 17:3010582-3010604 GGTATAAAGAGAGTGGCCTGAGG 0: 1
1: 0
2: 1
3: 15
4: 159
1142900829_1142900838 6 Left 1142900829 17:3010532-3010554 CCCATGGTGCCCAATGGAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1142900838 17:3010561-3010583 AGCAGCTAAATACAGGTGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 141
1142900829_1142900839 20 Left 1142900829 17:3010532-3010554 CCCATGGTGCCCAATGGAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1142900839 17:3010575-3010597 GGTGGCAGGTATAAAGAGAGTGG 0: 1
1: 0
2: 16
3: 39
4: 335
1142900829_1142900835 -1 Left 1142900829 17:3010532-3010554 CCCATGGTGCCCAATGGAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1142900835 17:3010554-3010576 GTGGTCCAGCAGCTAAATACAGG 0: 1
1: 0
2: 0
3: 4
4: 55
1142900829_1142900836 2 Left 1142900829 17:3010532-3010554 CCCATGGTGCCCAATGGAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1142900836 17:3010557-3010579 GTCCAGCAGCTAAATACAGGTGG 0: 1
1: 0
2: 0
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142900829 Original CRISPR CCTCCTCCATTGGGCACCAT GGG (reversed) Intronic