ID: 1142903890

View in Genome Browser
Species Human (GRCh38)
Location 17:3029748-3029770
Sequence CGCTGTGCCCCGCTGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142903890_1142903895 -6 Left 1142903890 17:3029748-3029770 CCTCCTGCCAGCGGGGCACAGCG 0: 1
1: 0
2: 0
3: 7
4: 175
Right 1142903895 17:3029765-3029787 ACAGCGGGAAATGTTGACACCGG 0: 1
1: 0
2: 0
3: 6
4: 112
1142903890_1142903896 -5 Left 1142903890 17:3029748-3029770 CCTCCTGCCAGCGGGGCACAGCG 0: 1
1: 0
2: 0
3: 7
4: 175
Right 1142903896 17:3029766-3029788 CAGCGGGAAATGTTGACACCGGG 0: 1
1: 0
2: 0
3: 5
4: 107
1142903890_1142903899 24 Left 1142903890 17:3029748-3029770 CCTCCTGCCAGCGGGGCACAGCG 0: 1
1: 0
2: 0
3: 7
4: 175
Right 1142903899 17:3029795-3029817 CACCACTCACACACACTTAACGG 0: 1
1: 1
2: 0
3: 23
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142903890 Original CRISPR CGCTGTGCCCCGCTGGCAGG AGG (reversed) Intronic