ID: 1142904820

View in Genome Browser
Species Human (GRCh38)
Location 17:3034533-3034555
Sequence CCCTTGGGCAGCTGCGTCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 333}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142904813_1142904820 -5 Left 1142904813 17:3034515-3034537 CCTTTTCCAGCTACTGTGCCCTT 0: 1
1: 0
2: 2
3: 23
4: 292
Right 1142904820 17:3034533-3034555 CCCTTGGGCAGCTGCGTCTGGGG 0: 1
1: 0
2: 0
3: 21
4: 333
1142904812_1142904820 2 Left 1142904812 17:3034508-3034530 CCTGGGGCCTTTTCCAGCTACTG 0: 1
1: 0
2: 1
3: 20
4: 197
Right 1142904820 17:3034533-3034555 CCCTTGGGCAGCTGCGTCTGGGG 0: 1
1: 0
2: 0
3: 21
4: 333
1142904810_1142904820 8 Left 1142904810 17:3034502-3034524 CCTGGCCCTGGGGCCTTTTCCAG 0: 1
1: 0
2: 6
3: 38
4: 405
Right 1142904820 17:3034533-3034555 CCCTTGGGCAGCTGCGTCTGGGG 0: 1
1: 0
2: 0
3: 21
4: 333
1142904811_1142904820 3 Left 1142904811 17:3034507-3034529 CCCTGGGGCCTTTTCCAGCTACT 0: 1
1: 0
2: 2
3: 26
4: 186
Right 1142904820 17:3034533-3034555 CCCTTGGGCAGCTGCGTCTGGGG 0: 1
1: 0
2: 0
3: 21
4: 333
1142904809_1142904820 12 Left 1142904809 17:3034498-3034520 CCAGCCTGGCCCTGGGGCCTTTT 0: 1
1: 0
2: 11
3: 44
4: 416
Right 1142904820 17:3034533-3034555 CCCTTGGGCAGCTGCGTCTGGGG 0: 1
1: 0
2: 0
3: 21
4: 333
1142904808_1142904820 13 Left 1142904808 17:3034497-3034519 CCCAGCCTGGCCCTGGGGCCTTT 0: 1
1: 0
2: 9
3: 72
4: 575
Right 1142904820 17:3034533-3034555 CCCTTGGGCAGCTGCGTCTGGGG 0: 1
1: 0
2: 0
3: 21
4: 333
1142904803_1142904820 30 Left 1142904803 17:3034480-3034502 CCTGGAGTCTTGGGGGGCCCAGC 0: 1
1: 0
2: 2
3: 33
4: 296
Right 1142904820 17:3034533-3034555 CCCTTGGGCAGCTGCGTCTGGGG 0: 1
1: 0
2: 0
3: 21
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142904820 Original CRISPR CCCTTGGGCAGCTGCGTCTG GGG Exonic
900119998 1:1044592-1044614 CATTTGTGCAGCTGCGTGTGTGG + Intronic
900358535 1:2276441-2276463 CCCTGGGCCACCTGCTTCTGTGG + Intronic
900573122 1:3369513-3369535 CCGCTGGGCAGCTGGGTATGAGG + Intronic
901057799 1:6456877-6456899 CCATTGGCCACCTGCCTCTGCGG + Intronic
901157685 1:7151416-7151438 CCCTTGGGTGTCTGTGTCTGGGG + Intronic
901495666 1:9620089-9620111 CCCATGGGCTGCTGTGTCTATGG + Intergenic
902335170 1:15750313-15750335 CCCTGGGGCAGCTGGGATTGGGG + Intergenic
902556661 1:17250791-17250813 CCGTTGGGCAGATGTGTCTCCGG + Intronic
903218287 1:21855010-21855032 CCGTTGTCCAGCTGCCTCTGGGG - Intronic
903470154 1:23581351-23581373 CTCTTGGGCAGCTGCTTCCTGGG + Intergenic
905060805 1:35137489-35137511 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
905502547 1:38451166-38451188 CCCACGGACAGCTGCCTCTGAGG + Intergenic
907292348 1:53424869-53424891 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
907503865 1:54903062-54903084 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
909369735 1:74870081-74870103 AGCTTGGGCAGCTGCTTCAGAGG + Intergenic
912296194 1:108473497-108473519 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
912515682 1:110215278-110215300 CCCATGGGCAGCTGCTGCTGTGG + Intronic
913248035 1:116887583-116887605 CCCTGGGGCATCTGCTTCTAGGG - Intergenic
917928246 1:179806616-179806638 CCCTTGGGAAGGTGGCTCTGTGG + Intronic
918234287 1:182563352-182563374 TCTTTGGGCAACTGCGTATGTGG - Intergenic
919787654 1:201270065-201270087 CTCTTGTGCAGCTTCCTCTGGGG - Intergenic
919977533 1:202622651-202622673 CGCTTGTGCAGCTGTGTGTGGGG + Intronic
920135171 1:203763689-203763711 AACTTGGGCAGCTGCCTCTGAGG + Intergenic
920690366 1:208141994-208142016 CCCTTGAGCAGCAGACTCTGTGG + Intronic
921509006 1:216008656-216008678 CCCTTGGGCTGGTGGGTCTGAGG - Intronic
922421242 1:225462312-225462334 CCCTGGGACAGCAGCGGCTGTGG - Intergenic
922934527 1:229412918-229412940 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
923017122 1:230135590-230135612 CCCTTGTGGAGCTGAGTGTGGGG + Intronic
924449131 1:244162048-244162070 CCCTCGGGCAGCTCTGTCTGTGG - Intergenic
924522987 1:244821579-244821601 CCCTCGGGCGGCTCTGTCTGTGG + Intergenic
1065437345 10:25716936-25716958 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1068523632 10:58104621-58104643 CCCTTGGGCAAGTGCTCCTGTGG + Intergenic
1068592702 10:58866756-58866778 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
1071573767 10:86711643-86711665 CCCGGGGGGAGCTGCGGCTGCGG - Intronic
1071960802 10:90807840-90807862 TCCTTGGGCTGGTGGGTCTGAGG - Intronic
1072011591 10:91306797-91306819 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
1073460938 10:103665589-103665611 CCCTCTGGCAGCTGCCTCTTAGG + Intronic
1073589456 10:104742616-104742638 ACCTTGGACAGCTGGGCCTGGGG + Intronic
1076439434 10:130470611-130470633 CCCCTGGGCACCTGTCTCTGAGG + Intergenic
1076454295 10:130578729-130578751 TCCCTGGGCTGCTGCCTCTGTGG + Intergenic
1076751991 10:132547862-132547884 GCCTTTGGCAGCAGCGTCTGGGG + Intronic
1076876642 10:133219543-133219565 CCCGTGGACAGCTGTGGCTGGGG - Intronic
1077363922 11:2153865-2153887 CCCTTCGGCAGCCGCGCCTCTGG - Intronic
1077497997 11:2896008-2896030 CCCTCGGGCAGGTGCCTGTGGGG + Intronic
1077894191 11:6441525-6441547 CCCTTGGGCTAGTGAGTCTGGGG + Intronic
1078363805 11:10690898-10690920 CCCTTGGGGAGCTGAGTCAGAGG - Intronic
1078963783 11:16312645-16312667 CACTTGAGCAGCTGTGACTGAGG - Intronic
1079727380 11:23892401-23892423 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
1081807076 11:45896583-45896605 CCCTTGCGCTGCTGCCGCTGTGG - Intronic
1083291942 11:61695424-61695446 CCCTTAGGCAGGAGCTTCTGGGG - Intronic
1083322823 11:61857653-61857675 CCCTGGGGTAGCTGCCTCTCAGG + Intronic
1083492520 11:63023421-63023443 TCCTTGTGCAGCTGGGTCTTTGG - Intergenic
1083681564 11:64354066-64354088 CCCCTGGGGGGCTGCGCCTGGGG + Exonic
1086136561 11:83448061-83448083 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
1089396327 11:118138229-118138251 GGCTTGGGCAGCTGGGTTTGAGG + Intronic
1089860184 11:121583273-121583295 ACCTTGGGCAGCTCCCTCGGTGG - Intronic
1089952968 11:122547128-122547150 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1090927244 11:131259743-131259765 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
1091183363 11:133627288-133627310 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1092474181 12:8805384-8805406 TCCTTGGGCTGCTTGGTCTGAGG - Intergenic
1092853397 12:12650982-12651004 CCCTTGGGCTGCTCTGTCTATGG + Intergenic
1093711439 12:22334141-22334163 CCCATGGGCAGCCGGGTCCGCGG + Exonic
1094316352 12:29140229-29140251 TCCTTGGGCAGGTCAGTCTGAGG + Intergenic
1094807402 12:34106835-34106857 CCCTTGGGCTGCTGCATCAGTGG - Intergenic
1094825474 12:34266145-34266167 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1096097179 12:48943463-48943485 CCCTTTGGCTGCTGAGTTTGGGG - Intronic
1096658289 12:53105233-53105255 TCCTTGAGCAGGTGAGTCTGGGG + Exonic
1097542471 12:60957091-60957113 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
1098367383 12:69719067-69719089 ACCTGGGGCAGGTGTGTCTGTGG - Intergenic
1098628764 12:72703775-72703797 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1100940014 12:99715700-99715722 TCCTTGGGCTGATGGGTCTGAGG - Intronic
1102298983 12:111757695-111757717 CCCCTGGGCATGTGGGTCTGAGG - Intronic
1103233623 12:119353102-119353124 CCCTGAGACAGCTGCATCTGAGG - Intronic
1105777772 13:23678994-23679016 CCCTTGGCCAGCTGACTCTCTGG - Intergenic
1107465895 13:40650046-40650068 CCCTTGGGCTGCTTTGTCTACGG - Intronic
1108202387 13:48056866-48056888 TCCTTGGGCTGGTGGGTCTGAGG - Intronic
1108844684 13:54663165-54663187 CCCTAGGGCTGCTCTGTCTGTGG - Intergenic
1109352791 13:61206186-61206208 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1109370281 13:61413776-61413798 CGCTCTGGCAGCTGCGACTGCGG + Exonic
1109709938 13:66146482-66146504 TTCTTGGGCTGCTGGGTCTGAGG + Intergenic
1112889620 13:104213297-104213319 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
1113958695 13:114113298-114113320 CACTTGGGCAGATGCACCTGTGG + Intronic
1114385036 14:22245392-22245414 CCCTGTGGCAGATGAGTCTGGGG - Intergenic
1117396121 14:55312295-55312317 GCCTTGGGCAGCTCCACCTGTGG + Intronic
1118404907 14:65413133-65413155 TCGTGGGGCAGCTGCGGCTGAGG + Intronic
1119325633 14:73758520-73758542 CCTGTTGGCAGCTGCGGCTGGGG - Intronic
1119673357 14:76536659-76536681 CACTTGGGCTCCTGAGTCTGGGG - Intergenic
1119702735 14:76766325-76766347 ACCTTCAGCAGCTGGGTCTGGGG - Intronic
1120618030 14:86732099-86732121 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1120660265 14:87240258-87240280 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
1122208346 14:100159514-100159536 TCCTTGCGCCGCTGCGTGTGCGG + Exonic
1123141888 14:106087995-106088017 TCCTTGTGCACCTGCCTCTGAGG + Intergenic
1123699969 15:22907113-22907135 CCCATGGGCAGCTTTGTCTTAGG + Intronic
1124441143 15:29687418-29687440 CCCTTGGGCAGCTGCCAGTGTGG + Intergenic
1124493188 15:30171024-30171046 CGCTTGTGCAGCTGTGTGTGAGG + Intergenic
1124609323 15:31197505-31197527 ACCTGGAGCAGCTGGGTCTGAGG + Intergenic
1124750346 15:32367301-32367323 CGCTTGTGCAGCTGTGTGTGAGG - Intergenic
1126530421 15:49704220-49704242 TCCTTGGGCTGCTTGGTCTGAGG + Intergenic
1128482872 15:68054691-68054713 CCCATGGGGAGCTGGGGCTGGGG + Intronic
1129516474 15:76160550-76160572 CTCTTGGGCCGCTGTGGCTGTGG + Intronic
1130134311 15:81169267-81169289 CCCTCTGCCAGCTGAGTCTGGGG - Intronic
1130975203 15:88768573-88768595 CCCTGGGGCTGCTGAGCCTGAGG + Intergenic
1131243967 15:90773981-90774003 CTCTTGGGTTGCTGGGTCTGTGG + Intronic
1131447404 15:92511872-92511894 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1132929633 16:2452226-2452248 CCCTTGAGCAGCCCCTTCTGTGG + Intronic
1132994444 16:2815638-2815660 TCCTTGAGCAGCTGCTGCTGGGG + Intergenic
1132996578 16:2826789-2826811 CCCTTGAGCGGCTGCTGCTGCGG - Intergenic
1134414198 16:14029818-14029840 CCCATGGGCAGCATCCTCTGGGG + Intergenic
1134821442 16:17250740-17250762 CCCTTTGGCATCTCCTTCTGAGG - Intronic
1135985015 16:27177787-27177809 CCTTTGGGCATATGAGTCTGTGG - Intergenic
1136251469 16:29008394-29008416 CCCTGGGGCTGCTGGCTCTGGGG + Intergenic
1136495590 16:30641604-30641626 CCCTTTGGGAGCTGAGGCTGGGG + Intergenic
1136852696 16:33625715-33625737 CCCATGGGAAGCTGTGTCTCAGG - Intergenic
1137734097 16:50711491-50711513 ACCTTGGGAAGCTGAGTCTGGGG - Exonic
1138510809 16:57507599-57507621 CCCCAGTGCAGCTGGGTCTGTGG + Intergenic
1138555831 16:57770760-57770782 CCCCTGGCCTGCTGCGTCTCAGG - Intronic
1138759321 16:59522404-59522426 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
1139046134 16:63061995-63062017 CCCTGTGCCAGCTGAGTCTGGGG + Intergenic
1139116485 16:63960582-63960604 CACTTGGGCAACTGTGGCTGGGG - Intergenic
1139493223 16:67298476-67298498 GTCTTGGGCAGATGCGTATGAGG - Intronic
1139574022 16:67830114-67830136 GCCTTGGCCTGCTGCGTCTCCGG - Intronic
1140486248 16:75295980-75296002 CCCTTGGGCTGGTGGGGCTGGGG - Intronic
1140770354 16:78198147-78198169 TCCTGGGGCAGGTGCCTCTGGGG + Intronic
1141950552 16:87336491-87336513 CCCTTGGTCTGCTGGGTCGGAGG + Intronic
1142215612 16:88828376-88828398 GCAGTGGGCAGCTGCGGCTGTGG + Intronic
1142904820 17:3034533-3034555 CCCTTGGGCAGCTGCGTCTGGGG + Exonic
1144784103 17:17822499-17822521 CCCTTGGCCAGGTGGGGCTGAGG - Intronic
1146597585 17:34183724-34183746 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1148543998 17:48503041-48503063 ACCATGGGCAGCTGAGTCTGAGG - Intergenic
1151420015 17:73990993-73991015 GCCTTGGGCAGCCTCTTCTGGGG - Intergenic
1151540283 17:74761302-74761324 CCCTTGGGCAGCGGTGTCGGGGG + Intronic
1151622209 17:75253154-75253176 TCCTTGGGCTGGTGGGTCTGAGG - Intronic
1152511625 17:80793620-80793642 CCCCTGGTCACCTGTGTCTGTGG + Intronic
1152855752 17:82663935-82663957 CCCTGGTGCAGCTGGGGCTGGGG + Intronic
1152938013 17:83151981-83152003 CCCATGGGCAGCTGGGGCTCTGG + Intergenic
1153599945 18:6770742-6770764 CCCTTGGGCAGCTGAGTGAAGGG + Intronic
1156494439 18:37516741-37516763 CCCTTGTGTAGCTGGCTCTGAGG + Intronic
1156924314 18:42557568-42557590 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
1157561324 18:48648428-48648450 CCCTTTCCCAGCTGTGTCTGGGG + Intronic
1159164193 18:64682234-64682256 CCCTTGGGCTCGTGGGTCTGAGG - Intergenic
1159718035 18:71849607-71849629 GCCTTGGGCAGCTCCCCCTGTGG - Intergenic
1159900994 18:74045486-74045508 CCAATGGGCAGCTGGGTCTGAGG - Intergenic
1160102550 18:75936667-75936689 CCCTTGGGGTGCTCTGTCTGTGG - Intergenic
1160548869 18:79680323-79680345 CCCCCGGGCTGCTGCGTCCGCGG + Intronic
1160665335 19:325504-325526 CACTGGGGCAGCTGAGCCTGTGG - Intronic
1160692767 19:467394-467416 ACCTAGGCCAGCTGCCTCTGTGG + Intronic
1160948067 19:1652501-1652523 CCCTGGGGCAGCGGCGTGCGCGG + Intronic
1161323837 19:3653552-3653574 AACTTGGGCAGCAGCGTCCGCGG + Exonic
1161613654 19:5257762-5257784 CCCGTGGGCAGCAGGCTCTGGGG - Intronic
1162766682 19:12924199-12924221 CCCATGGGCAGCAGCATCTCTGG + Exonic
1164628710 19:29746853-29746875 GCCCTGGCCAGCAGCGTCTGTGG + Intergenic
1166730581 19:45057041-45057063 TCCTGGAGCAGCTGCCTCTGAGG + Intronic
1167689465 19:50975949-50975971 TCCTCGGTCAGCAGCGTCTGAGG + Intergenic
1168228262 19:55011894-55011916 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
925918381 2:8623329-8623351 CTCTTGGGATGCTGCGTTTGAGG - Intergenic
926414165 2:12632745-12632767 CCCTTGGGCAGTTTCCTATGGGG + Intergenic
927090510 2:19707224-19707246 CCCTGGGGCTGCTGCCTCTCTGG - Intergenic
927278153 2:21279322-21279344 CCCCTGGGCAGCTGACCCTGAGG - Intergenic
928779982 2:34806188-34806210 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
932743743 2:74313883-74313905 ACCTAGGGCAGCTGCCTCTTGGG - Intronic
933180095 2:79217184-79217206 TCCTTGGGCTGGTGGGTCTGAGG + Intronic
934101717 2:88659741-88659763 GCCTAAGGCAGCTGCGGCTGTGG + Intergenic
934581261 2:95441799-95441821 CCTTAGGGAAGCTGGGTCTGAGG - Intergenic
934598189 2:95634915-95634937 CCTTAGGGAAGCTGGGTCTGAGG + Intergenic
934854938 2:97723892-97723914 CCCTTGGCGAGCTCAGTCTGCGG + Intronic
934946520 2:98546431-98546453 CCCTTGGGCAGCCAGGGCTGTGG + Intronic
935378483 2:102424360-102424382 CACTTTGGCAGCTGAGACTGGGG - Exonic
936175692 2:110218433-110218455 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
939010656 2:136842065-136842087 CTCTGAGGCAGCTACGTCTGTGG + Intronic
940529895 2:154867827-154867849 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
940676097 2:156725303-156725325 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
943460400 2:188165777-188165799 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
943691107 2:190870492-190870514 ACTTTGGGCAGCTGAGGCTGAGG - Intergenic
943946724 2:194074579-194074601 TCCCTGTGCAGCTGGGTCTGGGG - Intergenic
943951563 2:194136020-194136042 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
945173161 2:207017730-207017752 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
945301770 2:208221406-208221428 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
945360842 2:208894269-208894291 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
945554482 2:211262279-211262301 TCCTTGGGCTGCTTGGTCTGAGG - Intergenic
946921422 2:224585150-224585172 CCCCTGGGCAGCCGCGGCGGCGG + Exonic
948358349 2:237398600-237398622 CCTGTGGGCAGCCCCGTCTGTGG - Intronic
948390351 2:237607298-237607320 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
948468023 2:238161442-238161464 CCCTTTGGGAGCTGCCTTTGAGG + Intronic
948770318 2:240248359-240248381 CCCTGAGGCAGCTGCCCCTGAGG - Intergenic
1168943551 20:1733015-1733037 TCCTTGGGCTGCTTGGTCTGAGG + Intergenic
1171783623 20:29443521-29443543 CCTTTTGGCTGCTGCTTCTGTGG - Intergenic
1172135113 20:32681483-32681505 GCCTGGGGCAGCTGGCTCTGGGG - Intergenic
1172666830 20:36605982-36606004 CCGTTGGCCAGCTGCGGCTGAGG - Exonic
1172932811 20:38598263-38598285 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
1174201504 20:48809459-48809481 CCCTGGGGCAGCTGCCTCCTGGG - Intronic
1175051484 20:56159593-56159615 CCACTGGGCAGCTGCTTCCGAGG - Intergenic
1175384184 20:58583748-58583770 CCCTTGGAGTGCTGTGTCTGGGG + Intergenic
1176248767 20:64110082-64110104 CCCTGGGGCTGCTGCTTTTGTGG - Intergenic
1177119276 21:17121994-17122016 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1177840956 21:26232953-26232975 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
1179654599 21:42837564-42837586 CCCTTGGGCTGCAGGGACTGGGG - Intergenic
1179825412 21:43962666-43962688 CCCTTGGGCAGCTGTAGCAGAGG + Intronic
1179890004 21:44330659-44330681 CCCAGGGGGAGCTGCGTGTGCGG - Exonic
1180113157 21:45675262-45675284 CTCTTGGGCAGCTGAGGCTGAGG + Intronic
1180616500 22:17131730-17131752 CCCTTGGGTGGCAGCTTCTGTGG - Exonic
1181427573 22:22854168-22854190 GCCATGGGCAGCTGAGACTGAGG - Intronic
1181570859 22:23767306-23767328 CACTTGGGCAGCTCCCTGTGTGG + Intronic
1181779882 22:25184971-25184993 CTCTTGTGCAGCTGAGCCTGGGG - Exonic
1182624264 22:31634475-31634497 CCCTTGGGGAGCTGCTGGTGGGG - Intronic
1183519279 22:38287159-38287181 ACCTTGGGGAGCTGCTGCTGGGG - Intergenic
1183640283 22:39088478-39088500 CCCAGGAGCAGCTGCGTGTGAGG - Intergenic
1184080236 22:42214177-42214199 CCCTTCTCCAGCTGCCTCTGTGG - Exonic
1184790366 22:46696228-46696250 CCCTAGGACAGCCCCGTCTGTGG + Intronic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
1185315753 22:50178455-50178477 CCCGTGGGCCGCTGTGGCTGTGG - Intronic
949534483 3:4985488-4985510 ACCGTGGGCAGCAGTGTCTGGGG + Intergenic
949827147 3:8177544-8177566 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
950604319 3:14064854-14064876 CACTGGGGCAGCTGCTGCTGGGG - Exonic
950876411 3:16278801-16278823 CCCTGGGGCAGATGCCTTTGGGG + Intronic
951299096 3:20972695-20972717 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
952343795 3:32466385-32466407 TCCTTGGGCTGGTGGGTCTGAGG + Intronic
954148527 3:48646184-48646206 CCCTTAGGAAGTTGCGTCCGTGG + Exonic
954328335 3:49875797-49875819 ACATTGGGGAGCTGCTTCTGTGG + Intergenic
954654983 3:52188885-52188907 CCCTTGGGCAGCTTGGTCCGAGG + Intergenic
954705700 3:52479419-52479441 CTCTTGGGCAGCTGGGACTAGGG - Intronic
957030607 3:75236261-75236283 CCCTTGGGCAGCTCCTTCACAGG - Intergenic
958182089 3:90072768-90072790 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
958256611 3:91332403-91332425 GCCTTGGGCAGCTCCACCTGAGG - Intergenic
959294149 3:104513930-104513952 CCTTTTTGCAGCTGAGTCTGGGG + Intergenic
960033208 3:113076678-113076700 CCTTTGGGCACCTTCCTCTGTGG - Intergenic
961375185 3:126460498-126460520 CCCTGGTGCAGCTGCAGCTGTGG - Intronic
961880732 3:130059662-130059684 TCCTTGGGCTGCTGGGTCTGAGG - Intergenic
962412580 3:135154217-135154239 CCATTGGGCTGCTCCGGCTGTGG - Exonic
962412657 3:135154813-135154835 CTCTTGAGCATCTGCTTCTGAGG + Intronic
963058301 3:141205409-141205431 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
964125779 3:153231986-153232008 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
964375544 3:156045216-156045238 TCCTTGGGCTGGTGGGTCTGAGG + Intronic
965070044 3:163908038-163908060 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
965258239 3:166444582-166444604 GCATTGGGCAGCTGCCTCTTGGG + Intergenic
965625180 3:170677726-170677748 TCCTTGGGCTGGTGGGTCTGAGG + Intronic
965640347 3:170823231-170823253 TCCTTGGGCTGGTGGGTCTGAGG + Intronic
965713094 3:171576889-171576911 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
967212454 3:187180688-187180710 TCCTTGGGCTGGTCCGTCTGAGG + Intronic
967444944 3:189555300-189555322 GGTTTGGGCAGCTGCATCTGTGG + Intergenic
968993111 4:3927950-3927972 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
969137758 4:5044344-5044366 TCCCTGGGCAGATGTGTCTGAGG - Intergenic
969427031 4:7130415-7130437 CCCCTGGGCTGCTGCGTGCGGGG - Intergenic
969431940 4:7160500-7160522 CCTTGGGGCTGCTGCGTCTCAGG + Intergenic
970029478 4:11658743-11658765 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
970386764 4:15564180-15564202 CCATTGGGAAGATGAGTCTGAGG + Intronic
970532467 4:16998301-16998323 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
970854333 4:20635444-20635466 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
971076074 4:23151491-23151513 CCCTAGGCCAGCTGAGTCTGGGG - Intergenic
971428063 4:26535299-26535321 CCCTTGAGCCGCAGAGTCTGAGG - Intergenic
973917839 4:55654581-55654603 CCCTTGTGTGGCTGGGTCTGGGG + Intergenic
977009940 4:91624192-91624214 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
978488144 4:109279453-109279475 CTCTTGAGCAGCTGGGACTGAGG - Intronic
979054894 4:115980748-115980770 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
979653240 4:123161013-123161035 ACCTTGGGCAGCTGAAACTGCGG + Intronic
980003629 4:127516629-127516651 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
980112231 4:128646075-128646097 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
981229443 4:142336054-142336076 CCAATGGGTAGCTGAGTCTGGGG - Intronic
982397007 4:154924030-154924052 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
982497419 4:156108772-156108794 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
982535132 4:156600747-156600769 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
982545064 4:156724073-156724095 GACTTGGGCAGCTGCGACTTGGG - Intergenic
983398587 4:167234399-167234421 CGCTCGGGCTGCTGCGGCTGGGG - Intronic
983452042 4:167923418-167923440 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
985382042 4:189404918-189404940 GCCTTGGGCAGCTCCTTCTTGGG - Intergenic
985553981 5:547187-547209 TCCTTGGGCAGCTGCTCCTGAGG - Intergenic
985722749 5:1498983-1499005 TCTTTGGGCATCTGGGTCTGTGG - Intronic
986278407 5:6302176-6302198 CTGTTGTGCAGCTGGGTCTGCGG - Intergenic
987755500 5:22095164-22095186 TCCTTGGGCTGGTGGGTCTGAGG - Intronic
988456140 5:31388805-31388827 GCCTTGGGCTGCTGCTTCAGAGG - Intergenic
990946448 5:61254429-61254451 CCTTAGGGAAGCTGAGTCTGGGG - Intergenic
992394360 5:76357808-76357830 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
993192372 5:84698771-84698793 CCCTTGGGCTGGTCGGTCTGAGG - Intergenic
996358850 5:122623798-122623820 TCCTTGGGCAGGTTGGTCTGAGG + Intergenic
996509620 5:124304273-124304295 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
998475901 5:142421617-142421639 CCCTAGTGCACCTGTGTCTGTGG + Intergenic
999802181 5:155048518-155048540 GCCTTGCCCAGCTGAGTCTGTGG + Intergenic
1000438293 5:161240478-161240500 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1000439423 5:161248922-161248944 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1000935950 5:167303146-167303168 TCCTTGGGCTGGTGGGTCTGAGG + Intronic
1001331780 5:170767331-170767353 TCCTTGGGCTGGTGGGTCTGAGG + Intronic
1001682500 5:173569356-173569378 CCCCTGGGCAGGTGCATCTGAGG - Intergenic
1001682919 5:173571783-173571805 CAGTTGGGCATCTGCATCTGGGG - Intergenic
1001885686 5:175288203-175288225 CCCTTCTGCTGCTGCCTCTGTGG - Intergenic
1001935484 5:175700547-175700569 CCTCTGGGCAGCTGTCTCTGAGG - Intergenic
1003512646 6:6794165-6794187 CCCTTGAGCTGCTACGTGTGTGG + Intergenic
1006683272 6:35812408-35812430 CCGTGGGGCAGCTGTGCCTGGGG + Intronic
1007429942 6:41770903-41770925 CCCTTGGGGAGCCGCGGCGGCGG + Exonic
1007719227 6:43875564-43875586 CCCTTGGGCTCATGAGTCTGGGG - Intergenic
1012674852 6:102102635-102102657 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1013205550 6:107941835-107941857 CACTTGGGCAGCTGCTGCAGTGG - Intronic
1014687469 6:124520380-124520402 CTCTTGTGCAGCAGCTTCTGGGG - Intronic
1014794319 6:125707189-125707211 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
1014947583 6:127516031-127516053 CCCCTGGGCGGCGGCGGCTGCGG + Exonic
1019700918 7:2474784-2474806 CCCTGGGGCAGCTGGGTGAGGGG - Intergenic
1019735788 7:2649214-2649236 CCCTTGGGCTGCTACGTGGGCGG + Intronic
1019810141 7:3159135-3159157 CCTTGGGGCTGCTGTGTCTGTGG - Intronic
1020315753 7:6904303-6904325 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1020988482 7:15166345-15166367 CCCCAGGGCAGCTGGGTGTGTGG + Intergenic
1021133944 7:16943388-16943410 CTGGTGGGCAGCTCCGTCTGCGG + Intergenic
1021500878 7:21330487-21330509 ACCTTGGGCAGCTGCAGCCGCGG + Intergenic
1021637041 7:22703889-22703911 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1021899138 7:25265942-25265964 CCCTTGAGCAGTTACGGCTGAGG + Intergenic
1023902266 7:44490758-44490780 CCGTGGGGCAGCTGGGTCTGGGG - Exonic
1028894308 7:96023443-96023465 ACCCTGGGCATCTGGGTCTGTGG + Intronic
1031685590 7:124729657-124729679 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1031777038 7:125918073-125918095 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1033410633 7:141114585-141114607 CCTTTGGGCAGGTGATTCTGAGG + Intronic
1033625359 7:143105601-143105623 TCCTTGGGCTGCTTGGTCTGAGG - Intergenic
1034055696 7:148032688-148032710 CCCAAGGGCTGCTGCTTCTGTGG - Intronic
1034840116 7:154387701-154387723 CCCTTTGGCAGCAGGGGCTGTGG - Intronic
1035272322 7:157727853-157727875 CCCTTGGACCCCTGAGTCTGTGG + Intronic
1035796544 8:2362573-2362595 CCCCTGGGGAGCTGCTTGTGGGG - Intergenic
1036071206 8:5441774-5441796 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
1036472642 8:9064669-9064691 TCCTTGGGCTGGTGGGTCTGAGG + Intronic
1037720752 8:21441854-21441876 CCGTTGGGCAGCTGAAGCTGGGG - Intergenic
1047856097 8:128914971-128914993 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1048045371 8:130767755-130767777 CCCTTGGTCACCAGCCTCTGAGG - Intergenic
1049332617 8:142063312-142063334 ACCTTGGGCGGCTGCCACTGAGG + Intergenic
1049607858 8:143538001-143538023 ACCTTGTGCTGCTGCGTCTCCGG + Exonic
1049642826 8:143723064-143723086 CCCATGGGCAGGTGCAGCTGAGG - Intergenic
1049791624 8:144475046-144475068 TCCTTGGGCACCTGGGTGTGGGG + Exonic
1052162892 9:25288694-25288716 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1052191538 9:25669432-25669454 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1052653020 9:31326857-31326879 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1053057683 9:35003807-35003829 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1053142472 9:35690233-35690255 CCCAGTGGCAGCTGCGGCTGGGG + Exonic
1055701092 9:78946727-78946749 CCCTTGGACTGCTGTGCCTGTGG - Intergenic
1055878245 9:80968744-80968766 GCCTTGGGCAGCTCCCTATGAGG + Intergenic
1057173068 9:92975443-92975465 CTCCTCGGCAGCTGCGTCTTCGG + Intronic
1057415654 9:94860095-94860117 CCTTGGGGCAGGTGCCTCTGAGG + Intronic
1057963477 9:99479449-99479471 CACTAGGGCAGCTGTGTTTGGGG - Intergenic
1058026524 9:100145990-100146012 TCCTTGGGCTGGTGGGTCTGAGG + Intronic
1058921172 9:109616415-109616437 CCATTGGTCAGCTGAGTCTTAGG + Intergenic
1059634150 9:116155238-116155260 CCGTTTCGCAGCCGCGTCTGGGG - Intronic
1060318725 9:122535625-122535647 TTCTTGGGCTGCTGGGTCTGAGG + Intergenic
1060407003 9:123377778-123377800 CCCTCGGGCTGCTCCGGCTGAGG - Exonic
1061017032 9:127987274-127987296 CCCTTGGTCAGCTGCTTCGGTGG - Intergenic
1061913760 9:133738472-133738494 CCTGTGGGCAGCTCCCTCTGAGG + Intronic
1062253213 9:135608620-135608642 ACCTGGGGCTGCTGGGTCTGTGG - Intergenic
1062587062 9:137254175-137254197 GCTCTGGGCAGCTGCTTCTGTGG + Intergenic
1062612762 9:137382424-137382446 CTCTTTGGCACCTGCGTGTGTGG - Intronic
1203550765 Un_KI270743v1:163870-163892 CTCTTGTGCGGCTGCGTGTGGGG - Intergenic
1185849643 X:3473568-3473590 TCCTTGGGCTGCTTGGTCTGAGG + Intergenic
1187975680 X:24702449-24702471 CCCATGGGCAGCTGCAGCAGTGG + Intronic
1188333269 X:28897583-28897605 TCCTTGGGCTGGTGGGTCTGAGG + Intronic
1189032043 X:37460737-37460759 TCCTTGGGCTGGTTCGTCTGAGG + Intronic
1192451506 X:71247935-71247957 CCCTTGGGTATCTGTGTCTCTGG - Intronic
1194366815 X:93023471-93023493 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1194660387 X:96624507-96624529 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1194874101 X:99164662-99164684 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
1196221268 X:113113859-113113881 TCCTTGGGCTGGTGGGTCTGAGG + Intergenic
1197470669 X:126863612-126863634 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic
1198162621 X:134022586-134022608 CCCTTGGGCAGCTGGGTTGATGG - Intergenic
1199772490 X:150983716-150983738 TGTTTGGGCAGCTGCGGCTGCGG + Intronic
1200675037 Y:6139727-6139749 TCCTTGGGCTGGTGGGTCTGAGG - Intergenic