ID: 1142904844

View in Genome Browser
Species Human (GRCh38)
Location 17:3034638-3034660
Sequence GGTCTGACCCACACCCAGAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142904844_1142904858 25 Left 1142904844 17:3034638-3034660 CCCATCTGGGTGTGGGTCAGACC 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1142904858 17:3034686-3034708 CTCCACAGAGCCCCCTTGCTGGG 0: 1
1: 0
2: 2
3: 23
4: 208
1142904844_1142904857 24 Left 1142904844 17:3034638-3034660 CCCATCTGGGTGTGGGTCAGACC 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1142904857 17:3034685-3034707 CCTCCACAGAGCCCCCTTGCTGG 0: 1
1: 0
2: 2
3: 32
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142904844 Original CRISPR GGTCTGACCCACACCCAGAT GGG (reversed) Exonic
900120204 1:1045614-1045636 GGCCTGACCCACACCTGGCTGGG + Intronic
900787692 1:4658977-4658999 CCTCTGACCCACACACAAATGGG + Intronic
903069582 1:20720497-20720519 GTTCTGTCCCACTCCCAGACGGG + Intronic
903766626 1:25739311-25739333 GGTCTGCCACACAGCCACATGGG + Intronic
906201061 1:43960714-43960736 AGTCTGACCCTCACCCTGAAAGG - Intronic
914962804 1:152221028-152221050 GCCCTGACCCAGACCCACATTGG + Exonic
917958640 1:180125443-180125465 GGTCTGCCCCCCAACCTGATAGG + Intergenic
918214460 1:182381237-182381259 GGTCTGACTCTCACCCAGGCTGG - Intergenic
921904634 1:220483786-220483808 GGTCCCACCCACTACCAGATGGG - Intergenic
922930172 1:229382678-229382700 GGTCTCACTCTCACCCAGACTGG + Intergenic
1065098306 10:22304977-22304999 GGTCTCACTCTCACCCAGACTGG - Intergenic
1066633194 10:37476932-37476954 GGTCTCACACTCACCCAGGTTGG - Intergenic
1070126732 10:73628360-73628382 GGTCTCACTCACACCCAGGCTGG + Intergenic
1071872810 10:89813974-89813996 GTTCTACCCCACACCCAGAAGGG + Intergenic
1073443549 10:103567412-103567434 GGTCTCACTCTCACCCAGGTTGG + Intronic
1074054267 10:109907909-109907931 GTTCTGCCCCACTCCCAGTTAGG + Intronic
1074956725 10:118397847-118397869 GGCCTGATCAGCACCCAGATGGG + Intergenic
1076331880 10:129676101-129676123 TGGCCGTCCCACACCCAGATGGG + Intronic
1076700662 10:132271028-132271050 GTTCTGAACCACAGTCAGATGGG + Intronic
1076874207 10:133208003-133208025 GGTCTGACCAGCTCCCAGAGAGG + Intronic
1077539784 11:3141030-3141052 GGGCTGACCCCCACCCAAGTTGG - Intronic
1078233566 11:9464159-9464181 GGTCTCACTCTCACCCAGACTGG + Intronic
1079148424 11:17875420-17875442 AGCTTGACCCACTCCCAGATCGG + Intronic
1079622279 11:22568221-22568243 GCTCTGTGCCACTCCCAGATGGG + Intergenic
1083782777 11:64926640-64926662 GGTCTGCCCCACCCACAGCTGGG + Intronic
1100198901 12:92277734-92277756 AATCTGACCCAAACCCAGCTGGG - Intergenic
1104014878 12:124955237-124955259 GATGTGGCCCACACCCACATTGG - Intronic
1105349297 13:19601718-19601740 GGTCGGACCCTCAGCCAGCTGGG - Intergenic
1107644523 13:42480034-42480056 GTTCTGACCAGCACCCAGAAAGG - Intergenic
1112498726 13:99926026-99926048 GGTCTTTCCCAAACACAGATCGG + Intergenic
1117246383 14:53890593-53890615 TGTCTGACCCCCACCCAGGAGGG - Intergenic
1119176660 14:72573503-72573525 ATTCTGACCCACAGGCAGATGGG + Intergenic
1121616654 14:95318465-95318487 GGTCTGCCCCACCCCTAGGTTGG - Intronic
1121671270 14:95712314-95712336 CCTATGACCCCCACCCAGATAGG - Exonic
1122154011 14:99739507-99739529 GGGCTGACCCTCTCCTAGATGGG - Intronic
1122691792 14:103535127-103535149 AGTCTGACCCCCTCCCAGGTGGG + Exonic
1124761579 15:32451506-32451528 CGTCTCACCCACTCCCAGCTTGG - Intronic
1126553666 15:49962420-49962442 TGTCTGGCCCAAACCAAGATAGG - Intronic
1128176661 15:65562178-65562200 GGTCTGACCTAAACCCAGCAAGG + Intronic
1128517673 15:68353041-68353063 GGTCTGACCCACAGCAAGGCAGG + Intronic
1130379269 15:83357775-83357797 AGTATGAGCTACACCCAGATAGG + Intergenic
1131379102 15:91949166-91949188 ACTCTGACACACACCCAAATTGG + Intronic
1133182422 16:4067470-4067492 GGTTTGACCCAGACCCATCTTGG - Intronic
1133406058 16:5525448-5525470 GCTCAGACTCACACCGAGATAGG + Intergenic
1133994520 16:10738322-10738344 GGACTGGGCCACAGCCAGATAGG + Intergenic
1135617638 16:23925715-23925737 GGTATGTCCATCACCCAGATAGG + Intronic
1136536246 16:30901600-30901622 GGTCTGACTCTCACCCAGGCTGG + Intronic
1137703511 16:50517630-50517652 GGTCTGTCCCAGTGCCAGATTGG - Intergenic
1139657988 16:68400641-68400663 TGTATGTCCCACACACAGATGGG + Intronic
1139795288 16:69478108-69478130 GGTCTCACTCTCACCCAGACTGG + Intergenic
1140025936 16:71290203-71290225 GGTCTTACCCTCACCCAGGCTGG + Intergenic
1140850444 16:78930305-78930327 GGTCTCCTCCACACCCAGACTGG + Intronic
1142707783 17:1707674-1707696 AGTCTGGCCCTCACCCTGATGGG + Exonic
1142904844 17:3034638-3034660 GGTCTGACCCACACCCAGATGGG - Exonic
1148756000 17:49973252-49973274 GGCCTCACCCAGACCCAGGTGGG + Exonic
1151507523 17:74539392-74539414 GGTCTGACCTTGACCCAGCTTGG + Intergenic
1153924556 18:9824693-9824715 GGTCCGCCCCACTCCCAGAGTGG + Intronic
1156881507 18:42086301-42086323 GGTCTTACCCACATACAGCTCGG + Exonic
1159078708 18:63710968-63710990 GGTCTTACACAGCCCCAGATGGG + Intronic
1162231487 19:9270635-9270657 GCTCGGAACCACAGCCAGATGGG - Intergenic
1164909178 19:31992000-31992022 GGTCTCACCCACACCAAGGAAGG + Intergenic
1165804036 19:38569523-38569545 GGTCTTACTCTCACCCAGGTTGG - Intronic
928279747 2:29935337-29935359 GCTATGACCCCCACCCAGACAGG + Intergenic
929225113 2:39504402-39504424 GGTCTGACCCATACTGATATGGG - Intergenic
932210785 2:69928227-69928249 AGTCTGGCCCACACCAAGATAGG + Intronic
933782142 2:85810273-85810295 GGTCTGCCCCACATCCTGTTGGG - Intergenic
935014183 2:99164350-99164372 GGTCTTACCCTCACCCAGGCTGG + Intronic
938137690 2:128772732-128772754 GAACTGACCCACACACAGAGAGG - Intergenic
940155919 2:150657280-150657302 GGTCTGACCCAGACCCATAAAGG + Intergenic
948890057 2:240903230-240903252 GTCCTGACCCACAGCCTGATGGG - Intergenic
1170432152 20:16285786-16285808 GGTCTCACTCTCACCCAGACTGG - Intronic
1172463528 20:35137858-35137880 GGTAAGACCCACACAGAGATGGG - Exonic
1173525907 20:43732418-43732440 TCTCTGACCCACACCCTGTTGGG + Intergenic
1174113346 20:48211063-48211085 GGGCGGAACCACTCCCAGATGGG + Intergenic
1180097130 21:45561159-45561181 GGTCTGAACAACACCCAGCTGGG + Intergenic
1181041104 22:20193018-20193040 GGCCTGACACAGCCCCAGATGGG - Intergenic
1181090819 22:20471305-20471327 AGGCAGACCCACACCCAGGTGGG - Intronic
1181138885 22:20788922-20788944 TGTCTGTCCCATACCCAGAAAGG + Intronic
1184578438 22:45394293-45394315 GGTCTCACTCTCACCCAGACTGG - Intronic
1184775138 22:46619364-46619386 GGTCTGGCCCTCACCCAGGCTGG + Intronic
1185197518 22:49481639-49481661 CGTCTGGCGCACACCCAGCTGGG + Intronic
949874732 3:8618702-8618724 TGCCTGCCCCACACCCAGAAGGG - Intergenic
951581214 3:24165691-24165713 GGAATGACCTCCACCCAGATAGG + Intronic
952217299 3:31290322-31290344 GTCCTGCCCCATACCCAGATTGG - Intergenic
952362827 3:32647752-32647774 GGTCTCACTCTCACCCAGGTTGG - Intergenic
957499254 3:81032728-81032750 GGTCTGAACCTAACCCATATTGG + Intergenic
962760967 3:138513529-138513551 AGTCTGACATACACCCAGATGGG - Intronic
969604883 4:8197505-8197527 AGTCTGACCCACAGGCAGAGGGG - Intronic
979550746 4:121988420-121988442 GGTCTGACCTACACCTACATTGG + Intergenic
995217638 5:109613682-109613704 GCTTTGACTCTCACCCAGATGGG + Intergenic
997300183 5:132798041-132798063 GGTCTCTGCCAGACCCAGATTGG + Intronic
997787198 5:136724323-136724345 GGCCTGCCCCATACCCAGAAGGG + Intergenic
999361769 5:150991844-150991866 GGTATGTCCCACCCCAAGATAGG + Intergenic
1001136777 5:169109009-169109031 GGTCTTACCCACACTCAAGTGGG - Intronic
1001260217 5:170222116-170222138 GGTCTCACTCACACCCAGACTGG - Intergenic
1002469142 5:179424415-179424437 AGTCTGTCCCACACCCAGTTTGG - Intergenic
1014458872 6:121670538-121670560 GGTCTCACCGTCACCCAGGTTGG - Intergenic
1019533017 7:1513086-1513108 GCTCTGCCCCACACCCAGGATGG + Intergenic
1023365640 7:39460639-39460661 GGCCTGACCCAGACTCAGGTGGG + Exonic
1025099397 7:56122801-56122823 GGTCTGACCCATACCAAGCTGGG - Intergenic
1025990287 7:66492280-66492302 GATCTGAACCATACCCAGTTGGG - Intergenic
1028939260 7:96502413-96502435 AGTCTGACTCACACCAGGATCGG - Intronic
1034285751 7:149882075-149882097 GGGCTGACCCACAGCGACATGGG - Intergenic
1037482164 8:19314456-19314478 GGGCTGGCCCAGACCCAGACCGG + Intronic
1042746923 8:72118676-72118698 GCTCTGACCCACAGGCAGATGGG + Intergenic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1049027596 8:140005880-140005902 GGTCTTACCGTCACCCAGACTGG - Intronic
1049151518 8:141038070-141038092 GTTCTGACTCATAACCAGATGGG - Intergenic
1049828455 8:144685274-144685296 GGGCACACCCACACCCACATTGG + Intergenic
1053478766 9:38400807-38400829 GGTCAGCCTCACACCCAGAATGG - Intergenic
1056690984 9:88808554-88808576 AGCTTGACCCACTCCCAGATAGG + Intergenic
1062320042 9:135986374-135986396 GGCCTGCCCCACTCCCAGGTGGG + Intergenic
1186250549 X:7661142-7661164 GTCCTGCCCCACACCCAGAAGGG - Intergenic
1186915656 X:14217082-14217104 GGTCTCACTCTCACCCAGACTGG - Intergenic
1194103914 X:89743902-89743924 AGTCTGACTCTCACCCAGACTGG + Intergenic
1194264099 X:91734114-91734136 GCTCTGTGCCACACCCAGGTGGG + Intergenic