ID: 1142904927

View in Genome Browser
Species Human (GRCh38)
Location 17:3035057-3035079
Sequence TCATTCCCACACACGTGGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 53}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142904927_1142904932 4 Left 1142904927 17:3035057-3035079 CCCCGCCACGTGTGTGGGAATGA 0: 1
1: 0
2: 1
3: 0
4: 53
Right 1142904932 17:3035084-3035106 GTCCTGTTTGCAAGCTGGAGAGG 0: 1
1: 0
2: 1
3: 17
4: 132
1142904927_1142904931 -1 Left 1142904927 17:3035057-3035079 CCCCGCCACGTGTGTGGGAATGA 0: 1
1: 0
2: 1
3: 0
4: 53
Right 1142904931 17:3035079-3035101 ATTGAGTCCTGTTTGCAAGCTGG 0: 1
1: 0
2: 2
3: 14
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142904927 Original CRISPR TCATTCCCACACACGTGGCG GGG (reversed) Exonic
900901034 1:5515995-5516017 CCAGTCCCACACAGGTGGTGGGG - Intergenic
904466604 1:30711782-30711804 TCCTCCCCACACAGGTGGGGAGG - Exonic
920596845 1:207280284-207280306 TCTGTCCCATACACGTGGCCAGG + Intergenic
920857449 1:209674926-209674948 CCATTGCCACACACGTGGGAAGG + Intergenic
922884315 1:229006397-229006419 TCATGCCCACACAGGAGGGGAGG - Intergenic
924741903 1:246799103-246799125 TCCTTCCCACCCACCTGGCTGGG - Intergenic
1069871392 10:71535328-71535350 TGATTCCCTCACACAGGGCGTGG + Intronic
1076002986 10:126927190-126927212 TCATGGTCACACACCTGGCGTGG - Intronic
1083700582 11:64475201-64475223 TCTTTCCCACACATGTGTCAGGG - Intergenic
1090325091 11:125879172-125879194 TAACTCCCACACATGTGGTGTGG - Intergenic
1091014739 11:132039717-132039739 TTATTCCCACACACCTGCCTTGG - Intronic
1092526297 12:9312230-9312252 CCATCACCACACACGTGGGGGGG - Intergenic
1097570660 12:61327061-61327083 ACATTCCCACACGGGTGGGGAGG + Intergenic
1105688771 13:22814610-22814632 TTTTCCCCACACACGTGGCAGGG + Intergenic
1106303362 13:28489076-28489098 TCATGCCCACACAGGAGGGGAGG + Intronic
1107282928 13:38756997-38757019 TCATTCTCAGACACGTGCAGAGG - Intronic
1120623621 14:86796714-86796736 TCATTCCCACACCCTTTGGGTGG + Intergenic
1121903894 14:97722211-97722233 TCTTTCCCACAAACGTGGTCTGG - Intergenic
1125033354 15:35095088-35095110 TCCTTACCATACACGTGGCTGGG - Intergenic
1125427022 15:39558538-39558560 TCACTCTCACACACCTGGTGAGG - Intergenic
1130979662 15:88803755-88803777 TCAGTCCCACACACCTGGCGAGG - Exonic
1132750687 16:1456057-1456079 TCCTTCCAACACACAGGGCGAGG + Intronic
1142904927 17:3035057-3035079 TCATTCCCACACACGTGGCGGGG - Exonic
1144206439 17:12982968-12982990 TCAGACCCACACACATGGCTGGG + Intronic
1155718294 18:28974654-28974676 TGATTCACACACACTTGGAGTGG + Intergenic
949070008 2:242018728-242018750 TCACTCCTGCACCCGTGGCGTGG - Intergenic
1170423275 20:16213464-16213486 TCATTACTACTCACGTGGCTAGG + Intergenic
1180915405 22:19482575-19482597 TCAGTCCCTGACATGTGGCGAGG - Intronic
1182584414 22:31335772-31335794 TACTTCCCACACACCTGGCAGGG + Exonic
1182829731 22:33295236-33295258 TCATGCCCACACACCTTGCCAGG - Intronic
1183663639 22:39235295-39235317 TCGGTGGCACACACGTGGCGGGG - Intronic
958036222 3:88173098-88173120 TCATTCCCACACATGTTCCCTGG - Intergenic
958667899 3:97163463-97163485 TCATTCCCACACATGTTTCCAGG + Intronic
962380162 3:134892227-134892249 TCATGCCCACACCCCTGGCAAGG - Intronic
968049226 3:195642666-195642688 TCACTCCTGCACCCGTGGCGTGG - Intergenic
972530036 4:39953438-39953460 TCATTCCAACACACTGGGAGTGG + Intronic
978093093 4:104741754-104741776 GCATGCACACACACGTGGTGAGG - Intergenic
978995476 4:115145610-115145632 TCATCCACACACACCTGGCTCGG - Intergenic
987443294 5:17984400-17984422 CAATTCTCACACACGTGGCATGG - Intergenic
988312156 5:29574081-29574103 TTTTTCCCACACACATGGCCAGG - Intergenic
991518010 5:67460956-67460978 TACTTCCCACACAGGTGGCATGG - Intergenic
993398607 5:87421386-87421408 TCATTCCCACACATGTTTCCTGG + Intergenic
997377192 5:133405676-133405698 TTATACCCTCACACGTGGCAAGG + Intronic
1004522288 6:16373428-16373450 TCTGTCCCACACACGTGTCTTGG + Intronic
1012369323 6:98483563-98483585 TCATTCCCACACTCATAGCCAGG + Intergenic
1019268933 7:135052-135074 CCATTCCCACCCAGGTGCCGAGG + Intergenic
1020134487 7:5579395-5579417 CCGTGCCCACACACGTGGCCAGG + Intergenic
1029865154 7:103619925-103619947 TCATTCCCACATTAGTGGCAGGG - Intronic
1032793572 7:135259898-135259920 TCTTTCCCACACAGCTGGCTTGG - Intergenic
1042412675 8:68482252-68482274 ACAGTTCCACACACGTGGGGAGG - Intronic
1056749713 9:89339239-89339261 GCATTCCCACAGACTTGGGGTGG + Intronic
1057730329 9:97602804-97602826 ACATTCACACACACGTGGACAGG + Intronic
1190531187 X:51378261-51378283 TGATTCCCATACCCGTGGAGGGG + Intergenic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1192998569 X:76538939-76538961 TCATTCCCACTCCCCTGGAGTGG + Intergenic