ID: 1142906155

View in Genome Browser
Species Human (GRCh38)
Location 17:3043596-3043618
Sequence GATGCATCTGTGCCACATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142906154_1142906155 -4 Left 1142906154 17:3043577-3043599 CCTGGAATCAAAGGACAGGGATG No data
Right 1142906155 17:3043596-3043618 GATGCATCTGTGCCACATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142906155 Original CRISPR GATGCATCTGTGCCACATGA AGG Intergenic
No off target data available for this crispr