ID: 1142906783

View in Genome Browser
Species Human (GRCh38)
Location 17:3048980-3049002
Sequence GGCGACAGCCAATGAGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142906783_1142906794 22 Left 1142906783 17:3048980-3049002 CCATCTCCTCATTGGCTGTCGCC No data
Right 1142906794 17:3049025-3049047 GCCCCTCCGGGGAGTGGAATCGG No data
1142906783_1142906796 23 Left 1142906783 17:3048980-3049002 CCATCTCCTCATTGGCTGTCGCC No data
Right 1142906796 17:3049026-3049048 CCCCTCCGGGGAGTGGAATCGGG No data
1142906783_1142906792 11 Left 1142906783 17:3048980-3049002 CCATCTCCTCATTGGCTGTCGCC No data
Right 1142906792 17:3049014-3049036 GACTTTGCTCAGCCCCTCCGGGG No data
1142906783_1142906791 10 Left 1142906783 17:3048980-3049002 CCATCTCCTCATTGGCTGTCGCC No data
Right 1142906791 17:3049013-3049035 CGACTTTGCTCAGCCCCTCCGGG No data
1142906783_1142906793 16 Left 1142906783 17:3048980-3049002 CCATCTCCTCATTGGCTGTCGCC No data
Right 1142906793 17:3049019-3049041 TGCTCAGCCCCTCCGGGGAGTGG No data
1142906783_1142906790 9 Left 1142906783 17:3048980-3049002 CCATCTCCTCATTGGCTGTCGCC No data
Right 1142906790 17:3049012-3049034 GCGACTTTGCTCAGCCCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142906783 Original CRISPR GGCGACAGCCAATGAGGAGA TGG (reversed) Intergenic
No off target data available for this crispr