ID: 1142907361

View in Genome Browser
Species Human (GRCh38)
Location 17:3053133-3053155
Sequence CTCTCTAAGCAAAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142907361_1142907368 -4 Left 1142907361 17:3053133-3053155 CCCTCCTCCCTTTGCTTAGAGAG No data
Right 1142907368 17:3053152-3053174 AGAGTACTGCTGTAGTTGGTGGG No data
1142907361_1142907366 -8 Left 1142907361 17:3053133-3053155 CCCTCCTCCCTTTGCTTAGAGAG No data
Right 1142907366 17:3053148-3053170 TTAGAGAGTACTGCTGTAGTTGG No data
1142907361_1142907367 -5 Left 1142907361 17:3053133-3053155 CCCTCCTCCCTTTGCTTAGAGAG No data
Right 1142907367 17:3053151-3053173 GAGAGTACTGCTGTAGTTGGTGG No data
1142907361_1142907369 25 Left 1142907361 17:3053133-3053155 CCCTCCTCCCTTTGCTTAGAGAG No data
Right 1142907369 17:3053181-3053203 ATTGTATACAGAAGTGTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142907361 Original CRISPR CTCTCTAAGCAAAGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr