ID: 1142909001

View in Genome Browser
Species Human (GRCh38)
Location 17:3071327-3071349
Sequence TTACTCAGCTTGTAAAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142908999_1142909001 13 Left 1142908999 17:3071291-3071313 CCACCAAGAATTAGAAGAGCAAT No data
Right 1142909001 17:3071327-3071349 TTACTCAGCTTGTAAAAGAATGG No data
1142909000_1142909001 10 Left 1142909000 17:3071294-3071316 CCAAGAATTAGAAGAGCAATAAT No data
Right 1142909001 17:3071327-3071349 TTACTCAGCTTGTAAAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142909001 Original CRISPR TTACTCAGCTTGTAAAAGAA TGG Intergenic
No off target data available for this crispr