ID: 1142909248

View in Genome Browser
Species Human (GRCh38)
Location 17:3072935-3072957
Sequence CTACAGCTGGGGAGCAACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142909248_1142909255 19 Left 1142909248 17:3072935-3072957 CCTCTGTTGCTCCCCAGCTGTAG No data
Right 1142909255 17:3072977-3072999 AGTCCCCCAGAGCCACCATGTGG No data
1142909248_1142909254 -9 Left 1142909248 17:3072935-3072957 CCTCTGTTGCTCCCCAGCTGTAG No data
Right 1142909254 17:3072949-3072971 CAGCTGTAGGACTTTGAGTTGGG No data
1142909248_1142909256 20 Left 1142909248 17:3072935-3072957 CCTCTGTTGCTCCCCAGCTGTAG No data
Right 1142909256 17:3072978-3073000 GTCCCCCAGAGCCACCATGTGGG No data
1142909248_1142909253 -10 Left 1142909248 17:3072935-3072957 CCTCTGTTGCTCCCCAGCTGTAG No data
Right 1142909253 17:3072948-3072970 CCAGCTGTAGGACTTTGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142909248 Original CRISPR CTACAGCTGGGGAGCAACAG AGG (reversed) Intergenic
No off target data available for this crispr