ID: 1142909252

View in Genome Browser
Species Human (GRCh38)
Location 17:3072948-3072970
Sequence CCAACTCAAAGTCCTACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142909252_1142909262 19 Left 1142909252 17:3072948-3072970 CCAGCTGTAGGACTTTGAGTTGG No data
Right 1142909262 17:3072990-3073012 CACCATGTGGGCATTCTTGTAGG No data
1142909252_1142909255 6 Left 1142909252 17:3072948-3072970 CCAGCTGTAGGACTTTGAGTTGG No data
Right 1142909255 17:3072977-3072999 AGTCCCCCAGAGCCACCATGTGG No data
1142909252_1142909256 7 Left 1142909252 17:3072948-3072970 CCAGCTGTAGGACTTTGAGTTGG No data
Right 1142909256 17:3072978-3073000 GTCCCCCAGAGCCACCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142909252 Original CRISPR CCAACTCAAAGTCCTACAGC TGG (reversed) Intergenic
No off target data available for this crispr