ID: 1142909256

View in Genome Browser
Species Human (GRCh38)
Location 17:3072978-3073000
Sequence GTCCCCCAGAGCCACCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142909247_1142909256 23 Left 1142909247 17:3072932-3072954 CCGCCTCTGTTGCTCCCCAGCTG No data
Right 1142909256 17:3072978-3073000 GTCCCCCAGAGCCACCATGTGGG No data
1142909251_1142909256 8 Left 1142909251 17:3072947-3072969 CCCAGCTGTAGGACTTTGAGTTG No data
Right 1142909256 17:3072978-3073000 GTCCCCCAGAGCCACCATGTGGG No data
1142909248_1142909256 20 Left 1142909248 17:3072935-3072957 CCTCTGTTGCTCCCCAGCTGTAG No data
Right 1142909256 17:3072978-3073000 GTCCCCCAGAGCCACCATGTGGG No data
1142909250_1142909256 9 Left 1142909250 17:3072946-3072968 CCCCAGCTGTAGGACTTTGAGTT No data
Right 1142909256 17:3072978-3073000 GTCCCCCAGAGCCACCATGTGGG No data
1142909252_1142909256 7 Left 1142909252 17:3072948-3072970 CCAGCTGTAGGACTTTGAGTTGG No data
Right 1142909256 17:3072978-3073000 GTCCCCCAGAGCCACCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142909256 Original CRISPR GTCCCCCAGAGCCACCATGT GGG Intergenic
No off target data available for this crispr