ID: 1142909981

View in Genome Browser
Species Human (GRCh38)
Location 17:3080656-3080678
Sequence CAAAATGTTGAAAGTGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142909981_1142909983 4 Left 1142909981 17:3080656-3080678 CCATTATCACTTTCAACATTTTG No data
Right 1142909983 17:3080683-3080705 AAACTATTCAACAAATCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142909981 Original CRISPR CAAAATGTTGAAAGTGATAA TGG (reversed) Intergenic
No off target data available for this crispr