ID: 1142912261

View in Genome Browser
Species Human (GRCh38)
Location 17:3104373-3104395
Sequence ATGAAGAAACGGGATGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142912255_1142912261 25 Left 1142912255 17:3104325-3104347 CCAATGAGATTTGTGGGATATGA No data
Right 1142912261 17:3104373-3104395 ATGAAGAAACGGGATGAACAGGG No data
1142912254_1142912261 26 Left 1142912254 17:3104324-3104346 CCCAATGAGATTTGTGGGATATG No data
Right 1142912261 17:3104373-3104395 ATGAAGAAACGGGATGAACAGGG No data
1142912253_1142912261 27 Left 1142912253 17:3104323-3104345 CCCCAATGAGATTTGTGGGATAT No data
Right 1142912261 17:3104373-3104395 ATGAAGAAACGGGATGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142912261 Original CRISPR ATGAAGAAACGGGATGAACA GGG Intergenic
No off target data available for this crispr