ID: 1142912399

View in Genome Browser
Species Human (GRCh38)
Location 17:3105804-3105826
Sequence TCTCATACACTGCTGGCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142912399_1142912401 10 Left 1142912399 17:3105804-3105826 CCTACTGCCAGCAGTGTATGAGA No data
Right 1142912401 17:3105837-3105859 CTCAATACCTTAACATGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142912399 Original CRISPR TCTCATACACTGCTGGCAGT AGG (reversed) Intergenic
No off target data available for this crispr