ID: 1142919139

View in Genome Browser
Species Human (GRCh38)
Location 17:3169345-3169367
Sequence AGAGAGAATGCAGTGAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142919127_1142919139 30 Left 1142919127 17:3169292-3169314 CCCATCCCCCAGCAGTGGCTACA No data
Right 1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG No data
1142919132_1142919139 23 Left 1142919132 17:3169299-3169321 CCCAGCAGTGGCTACATGGTGCA No data
Right 1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG No data
1142919128_1142919139 29 Left 1142919128 17:3169293-3169315 CCATCCCCCAGCAGTGGCTACAT No data
Right 1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG No data
1142919133_1142919139 22 Left 1142919133 17:3169300-3169322 CCAGCAGTGGCTACATGGTGCAG No data
Right 1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG No data
1142919131_1142919139 24 Left 1142919131 17:3169298-3169320 CCCCAGCAGTGGCTACATGGTGC No data
Right 1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG No data
1142919130_1142919139 25 Left 1142919130 17:3169297-3169319 CCCCCAGCAGTGGCTACATGGTG No data
Right 1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142919139 Original CRISPR AGAGAGAATGCAGTGAGTGT GGG Intergenic
No off target data available for this crispr