ID: 1142919453

View in Genome Browser
Species Human (GRCh38)
Location 17:3171667-3171689
Sequence ATCCTCTGGCATCTAGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142919453_1142919461 20 Left 1142919453 17:3171667-3171689 CCTTCACCTAGATGCCAGAGGAT No data
Right 1142919461 17:3171710-3171732 CAGGCAGAAGTCTGCTGCAGAGG 0: 272
1: 1237
2: 1832
3: 1380
4: 1140
1142919453_1142919458 1 Left 1142919453 17:3171667-3171689 CCTTCACCTAGATGCCAGAGGAT No data
Right 1142919458 17:3171691-3171713 TATGGGAAAGCCTGACATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142919453 Original CRISPR ATCCTCTGGCATCTAGGTGA AGG (reversed) Intergenic
No off target data available for this crispr