ID: 1142923548

View in Genome Browser
Species Human (GRCh38)
Location 17:3212609-3212631
Sequence TTCTATTTGAAGAAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142923540_1142923548 16 Left 1142923540 17:3212570-3212592 CCAGATTTACTGAACGATTTGAC No data
Right 1142923548 17:3212609-3212631 TTCTATTTGAAGAAGGGGGAGGG No data
1142923542_1142923548 -8 Left 1142923542 17:3212594-3212616 CCTGAGGTATTATGATTCTATTT No data
Right 1142923548 17:3212609-3212631 TTCTATTTGAAGAAGGGGGAGGG No data
1142923539_1142923548 21 Left 1142923539 17:3212565-3212587 CCTCTCCAGATTTACTGAACGAT No data
Right 1142923548 17:3212609-3212631 TTCTATTTGAAGAAGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142923548 Original CRISPR TTCTATTTGAAGAAGGGGGA GGG Intergenic
No off target data available for this crispr