ID: 1142925561

View in Genome Browser
Species Human (GRCh38)
Location 17:3232915-3232937
Sequence TTACTCAGCTTGTAAAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142925561_1142925562 10 Left 1142925561 17:3232915-3232937 CCATTCTTTTACAAGCTGAGTAA No data
Right 1142925562 17:3232948-3232970 ATTATTGCTCTTCTAATTCTTGG No data
1142925561_1142925563 13 Left 1142925561 17:3232915-3232937 CCATTCTTTTACAAGCTGAGTAA No data
Right 1142925563 17:3232951-3232973 ATTGCTCTTCTAATTCTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142925561 Original CRISPR TTACTCAGCTTGTAAAAGAA TGG (reversed) Intergenic
No off target data available for this crispr