ID: 1142927202

View in Genome Browser
Species Human (GRCh38)
Location 17:3251108-3251130
Sequence CTCTCTAAGCAAAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142927195_1142927202 -4 Left 1142927195 17:3251089-3251111 CCCACCAACTACAGCAGTACTCT No data
Right 1142927202 17:3251108-3251130 CTCTCTAAGCAAAGGGAGGAGGG No data
1142927196_1142927202 -5 Left 1142927196 17:3251090-3251112 CCACCAACTACAGCAGTACTCTC No data
Right 1142927202 17:3251108-3251130 CTCTCTAAGCAAAGGGAGGAGGG No data
1142927197_1142927202 -8 Left 1142927197 17:3251093-3251115 CCAACTACAGCAGTACTCTCTAA No data
Right 1142927202 17:3251108-3251130 CTCTCTAAGCAAAGGGAGGAGGG No data
1142927194_1142927202 25 Left 1142927194 17:3251060-3251082 CCAAATACACTTCTGTATACAAT No data
Right 1142927202 17:3251108-3251130 CTCTCTAAGCAAAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142927202 Original CRISPR CTCTCTAAGCAAAGGGAGGA GGG Intergenic
No off target data available for this crispr