ID: 1142930719

View in Genome Browser
Species Human (GRCh38)
Location 17:3282022-3282044
Sequence ATGGAGAAAAACAATGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142930719_1142930725 8 Left 1142930719 17:3282022-3282044 CCCTCTTCATTGTTTTTCTCCAT No data
Right 1142930725 17:3282053-3282075 TGAAGGTCACCAGCCCTTTTAGG No data
1142930719_1142930722 -9 Left 1142930719 17:3282022-3282044 CCCTCTTCATTGTTTTTCTCCAT No data
Right 1142930722 17:3282036-3282058 TTTCTCCATACCGGACATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142930719 Original CRISPR ATGGAGAAAAACAATGAAGA GGG (reversed) Intergenic
No off target data available for this crispr