ID: 1142930956

View in Genome Browser
Species Human (GRCh38)
Location 17:3283848-3283870
Sequence TTGTATCTCTAGCTGTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142930956_1142930960 -6 Left 1142930956 17:3283848-3283870 CCCTCAGACAGCTAGAGATACAA No data
Right 1142930960 17:3283865-3283887 ATACAATTGCTTAAAACCAGGGG No data
1142930956_1142930965 14 Left 1142930956 17:3283848-3283870 CCCTCAGACAGCTAGAGATACAA No data
Right 1142930965 17:3283885-3283907 GGGGATTCTGGGATGACCTCAGG No data
1142930956_1142930961 -5 Left 1142930956 17:3283848-3283870 CCCTCAGACAGCTAGAGATACAA No data
Right 1142930961 17:3283866-3283888 TACAATTGCTTAAAACCAGGGGG No data
1142930956_1142930962 2 Left 1142930956 17:3283848-3283870 CCCTCAGACAGCTAGAGATACAA No data
Right 1142930962 17:3283873-3283895 GCTTAAAACCAGGGGGATTCTGG No data
1142930956_1142930959 -7 Left 1142930956 17:3283848-3283870 CCCTCAGACAGCTAGAGATACAA No data
Right 1142930959 17:3283864-3283886 GATACAATTGCTTAAAACCAGGG No data
1142930956_1142930963 3 Left 1142930956 17:3283848-3283870 CCCTCAGACAGCTAGAGATACAA No data
Right 1142930963 17:3283874-3283896 CTTAAAACCAGGGGGATTCTGGG No data
1142930956_1142930958 -8 Left 1142930956 17:3283848-3283870 CCCTCAGACAGCTAGAGATACAA No data
Right 1142930958 17:3283863-3283885 AGATACAATTGCTTAAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142930956 Original CRISPR TTGTATCTCTAGCTGTCTGA GGG (reversed) Intergenic
No off target data available for this crispr