ID: 1142931584

View in Genome Browser
Species Human (GRCh38)
Location 17:3289521-3289543
Sequence GATCTTTGGAGATAAACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142931578_1142931584 26 Left 1142931578 17:3289472-3289494 CCTTGAGGCTTGAAGTAAAGAGC No data
Right 1142931584 17:3289521-3289543 GATCTTTGGAGATAAACAGCAGG No data
1142931580_1142931584 4 Left 1142931580 17:3289494-3289516 CCAGCTGAAGAAATGCCAGAGGC No data
Right 1142931584 17:3289521-3289543 GATCTTTGGAGATAAACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142931584 Original CRISPR GATCTTTGGAGATAAACAGC AGG Intergenic
No off target data available for this crispr