ID: 1142941420

View in Genome Browser
Species Human (GRCh38)
Location 17:3382705-3382727
Sequence GGGAGTGGAAAGGGCATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142941420_1142941427 -2 Left 1142941420 17:3382705-3382727 CCTGAAATGCCCTTTCCACTCCC No data
Right 1142941427 17:3382726-3382748 CCAAGCATCTGTATATCTGGTGG No data
1142941420_1142941424 -5 Left 1142941420 17:3382705-3382727 CCTGAAATGCCCTTTCCACTCCC No data
Right 1142941424 17:3382723-3382745 CTCCCAAGCATCTGTATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142941420 Original CRISPR GGGAGTGGAAAGGGCATTTC AGG (reversed) Intergenic
No off target data available for this crispr