ID: 1142944459

View in Genome Browser
Species Human (GRCh38)
Location 17:3412661-3412683
Sequence TTGTATCTCTAGCTGTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142944457_1142944459 -8 Left 1142944457 17:3412646-3412668 CCTGGTTTTAAGCAATTGTATCT No data
Right 1142944459 17:3412661-3412683 TTGTATCTCTAGCTGTCTGAGGG No data
1142944454_1142944459 -5 Left 1142944454 17:3412643-3412665 CCCCCTGGTTTTAAGCAATTGTA No data
Right 1142944459 17:3412661-3412683 TTGTATCTCTAGCTGTCTGAGGG No data
1142944453_1142944459 2 Left 1142944453 17:3412636-3412658 CCAGAATCCCCCTGGTTTTAAGC No data
Right 1142944459 17:3412661-3412683 TTGTATCTCTAGCTGTCTGAGGG No data
1142944455_1142944459 -6 Left 1142944455 17:3412644-3412666 CCCCTGGTTTTAAGCAATTGTAT No data
Right 1142944459 17:3412661-3412683 TTGTATCTCTAGCTGTCTGAGGG No data
1142944452_1142944459 3 Left 1142944452 17:3412635-3412657 CCCAGAATCCCCCTGGTTTTAAG No data
Right 1142944459 17:3412661-3412683 TTGTATCTCTAGCTGTCTGAGGG No data
1142944456_1142944459 -7 Left 1142944456 17:3412645-3412667 CCCTGGTTTTAAGCAATTGTATC No data
Right 1142944459 17:3412661-3412683 TTGTATCTCTAGCTGTCTGAGGG No data
1142944450_1142944459 14 Left 1142944450 17:3412624-3412646 CCTGAGGTCATCCCAGAATCCCC No data
Right 1142944459 17:3412661-3412683 TTGTATCTCTAGCTGTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142944459 Original CRISPR TTGTATCTCTAGCTGTCTGA GGG Intergenic
No off target data available for this crispr