ID: 1142948199

View in Genome Browser
Species Human (GRCh38)
Location 17:3453529-3453551
Sequence CACAGCTAACATCATAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 566
Summary {0: 2, 1: 0, 2: 14, 3: 144, 4: 406}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142948193_1142948199 8 Left 1142948193 17:3453498-3453520 CCAACACAATAAAGGTCATTTGC 0: 1
1: 0
2: 1
3: 17
4: 164
Right 1142948199 17:3453529-3453551 CACAGCTAACATCATAATGGGGG 0: 2
1: 0
2: 14
3: 144
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142948199 Original CRISPR CACAGCTAACATCATAATGG GGG Intronic
906706810 1:47900989-47901011 CACAACTAACCTAATGATGGAGG - Intronic
906862761 1:49379489-49379511 CACAGCCAATATCATACTGAAGG - Intronic
906977482 1:50591061-50591083 CACAGCAAACATCATACTCAAGG - Intronic
906995068 1:50784068-50784090 CACAGCTAACATCATATTCAAGG + Intronic
908335763 1:63121158-63121180 ATCAGCTCACATGATAATGGAGG - Intergenic
908818889 1:68062215-68062237 CACAGCCAACATCTTACTGAAGG + Intergenic
908981151 1:69960862-69960884 CACAGCCAATATCATACTGAAGG + Intronic
909271933 1:73633756-73633778 CACAGCTAGTATCATACTGAAGG + Intergenic
909343198 1:74554587-74554609 ACCAGCTAGCATCATAATGACGG + Intergenic
909616152 1:77610853-77610875 CACAGCTGACATCATACTCAAGG + Intronic
910151661 1:84154911-84154933 CTCAGCTAACATCTTAATAGCGG + Intronic
910954268 1:92684509-92684531 ACCAGCTAACATCACAATGACGG + Intronic
911310379 1:96285435-96285457 CACAGCCAACATTATATTGAAGG - Intergenic
912071219 1:105812034-105812056 CACAGCTAGTATCATACTGAAGG + Intergenic
912171132 1:107100827-107100849 CACAGGGAAAATCATAATGCAGG + Intergenic
913394452 1:118350850-118350872 GCCAGCTAACATCATAATGACGG + Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
914997348 1:152556532-152556554 CACAGCCAACATCATACTGAAGG + Intronic
915851487 1:159328872-159328894 CACAGCCAATATCATACTGAAGG + Intergenic
917259931 1:173155829-173155851 ACCAGCGAACATCATAATGACGG + Intergenic
917608200 1:176657850-176657872 CATGGCTAACATCCTAATAGGGG + Intronic
917915450 1:179696439-179696461 ATCAGCTAGCATCATAATGACGG + Intergenic
918021468 1:180696598-180696620 CACAGCCAACATCATACTGAAGG - Intronic
918089638 1:181277937-181277959 ACCAGCTAACATCATAATGATGG + Intergenic
918195939 1:182221329-182221351 ACCAGCTAGCATCATAATGATGG + Intergenic
918503482 1:185225027-185225049 CATAGTTAACATCATACTGAAGG - Intronic
918538543 1:185602627-185602649 CACAGCTTTCATCAGAAGGGGGG + Intergenic
918616384 1:186549335-186549357 CCCAGCTAACATCATAATGAAGG - Intergenic
918873805 1:190011919-190011941 CACAGCCAACATAATACTGAAGG + Intergenic
920064760 1:203260070-203260092 ACCAGCTAACATCATAATGGTGG + Intronic
920769931 1:208874305-208874327 CACAGATACCATCAGAAAGGAGG - Intergenic
921646642 1:217626376-217626398 AAAAGCTAATATGATAATGGAGG - Intronic
921976545 1:221209006-221209028 ACCAGCTAGCATCATAATGATGG + Intergenic
923194274 1:231650097-231650119 ACCAGCTAACATCATAATGATGG - Intronic
924933561 1:248749238-248749260 CAGACCTAACAGCAAAATGGGGG + Intronic
1063049203 10:2427499-2427521 CACAGCTAACATCATAACTGAGG + Intergenic
1064108039 10:12517481-12517503 TACAGCTAACATCATACTTTAGG - Intronic
1064814311 10:19240676-19240698 CACAGCTAACATCTTATTTATGG - Intronic
1064815758 10:19259926-19259948 TGCAACTAACATCATTATGGGGG - Intronic
1064904973 10:20335951-20335973 CACAGCCAATATCATACTGAAGG - Intergenic
1064919345 10:20499662-20499684 ACCAGCTACCATCATAATGACGG - Intergenic
1065152971 10:22841094-22841116 CCCAGCTATTATCATGATGGAGG + Intergenic
1067215955 10:44303251-44303273 CACAGCTAACATAATACTGAAGG + Intergenic
1067240700 10:44490191-44490213 CACAGCCAATATCATACTGAGGG + Intergenic
1067342033 10:45413473-45413495 CACAGCCAATATCATACTGAAGG + Intronic
1068141156 10:53009119-53009141 CAAATCTCACATCATATTGGAGG - Intergenic
1068190363 10:53643577-53643599 CACAGCTACTAGCATAATGATGG + Intergenic
1068423662 10:56827646-56827668 CACAGCCAACATCATGCTGAAGG + Intergenic
1069173023 10:65256203-65256225 CACAGATAGCATCATACTGAAGG + Intergenic
1069808616 10:71142079-71142101 CCCAGGTAGCACCATAATGGAGG + Intergenic
1070059736 10:72970343-72970365 CACAGCTAACATCATACTCAAGG - Intergenic
1070094713 10:73325443-73325465 ACCAGCTAACATCATAATGACGG + Intronic
1071894197 10:90047187-90047209 CACAGCCAACATTATATTGAAGG - Intergenic
1072164149 10:92796257-92796279 CACAGCCAACATAATATTGAAGG + Intergenic
1073913401 10:108373429-108373451 CACAGCCAATATCATACTGAAGG - Intergenic
1073949939 10:108795742-108795764 CACAGCCAATATCATACTGAAGG - Intergenic
1073966470 10:108996243-108996265 CACAGCCAATATCATACTGAAGG + Intergenic
1074017496 10:109548396-109548418 ACCACCTAACATCATAATGACGG + Intergenic
1074210262 10:111325765-111325787 CACAGCCAACATCATACTGATGG + Intergenic
1074637698 10:115339811-115339833 CACAGCTAGTATCATACTGAAGG - Intronic
1075990162 10:126830307-126830329 CACAGCTAACATCTTACTGATGG + Intergenic
1077696649 11:4398961-4398983 CCCAGCTAGCATCATAATGACGG + Intergenic
1078297059 11:10082765-10082787 CACAGTCAACATCATACTGAAGG + Intronic
1078686980 11:13541838-13541860 CACAGCCAACATCATACTGATGG - Intergenic
1079964794 11:26967085-26967107 ACCAGCTAACATCATAATGATGG + Intergenic
1079988421 11:27221672-27221694 ACCAGCTAACATCATAATGACGG + Intergenic
1080081184 11:28220596-28220618 ACCAACTAACATCATAATGACGG - Intronic
1080211263 11:29788301-29788323 CACAGCTAATATCATACTGAAGG + Intergenic
1081010079 11:37800239-37800261 AACAGCCAACATCATACTGAAGG + Intergenic
1081241230 11:40709239-40709261 ACCAGCTAACATCATAATGACGG - Intronic
1081363503 11:42207435-42207457 ACCAGCTAGCATCATAATGACGG + Intergenic
1081725731 11:45327506-45327528 CACAGCTAACATGATATTTAAGG + Intergenic
1082269179 11:50150945-50150967 ACCAGTTAACATCATAATGACGG + Intergenic
1082286940 11:50328142-50328164 ACCAGTTAACATCATAATGACGG - Intergenic
1082638561 11:55626976-55626998 ACCAGCTAACATCATGACGGTGG - Intergenic
1083032907 11:59610519-59610541 CACAGCCAACATCACCGTGGAGG - Exonic
1083481921 11:62954457-62954479 CACTGCTAACTTGATAAAGGCGG + Intronic
1084926157 11:72513450-72513472 GAAAGCTAAAATCATAATTGAGG - Intergenic
1086312076 11:85547038-85547060 ACCAGCTGGCATCATAATGGAGG - Intronic
1086505950 11:87504395-87504417 CACAGCCAATATCATACTGAAGG - Intergenic
1086765338 11:90689726-90689748 ACCAGCTAACATCATAATGATGG - Intergenic
1086923636 11:92616511-92616533 ACCAGCTAACATCATAATGATGG - Intronic
1087120942 11:94573399-94573421 CACAGCCAATATCATACTGAAGG - Intronic
1087304877 11:96477085-96477107 CACAGCTAACATCATAGTGAAGG + Intronic
1087720462 11:101659366-101659388 CACAGCTAATATCATACAGAAGG - Intronic
1088078093 11:105876947-105876969 ATCAGCTAGCATCATAATGATGG - Intronic
1089580855 11:119481342-119481364 CAGAGATTACATCCTAATGGGGG - Intergenic
1090724877 11:129516125-129516147 ACCAGCTAGCATCATAATGACGG - Intergenic
1091381138 12:61164-61186 CACAGCCAACATTATATTGAAGG + Intergenic
1091851512 12:3702183-3702205 AACAGCTAACATCATACTTAAGG + Intronic
1092259466 12:6945095-6945117 CACACCTGACTTCATAGTGGGGG - Intronic
1092332354 12:7596304-7596326 ACCAGCTAGCATCATAATGACGG + Intergenic
1092605119 12:10110316-10110338 CACAGCCAACATCATACGGAAGG + Intronic
1092730648 12:11530701-11530723 CACAGCCAATATCATACTGAAGG - Intergenic
1092851298 12:12629716-12629738 CACAGCTAACATCTTACTAATGG - Intronic
1093179079 12:15947743-15947765 ACCAGCTAACATCATAATGACGG - Intronic
1093603484 12:21060323-21060345 CACAGCCAACAACATACTGAGGG - Intronic
1094220746 12:27990539-27990561 CACAGCTAGCATTATACTGAAGG + Intergenic
1095677394 12:44935723-44935745 CACAGCCAATATCATACTGAAGG + Intergenic
1097525328 12:60727238-60727260 CACAGCCAATATCATACTGAAGG + Intergenic
1097561152 12:61207918-61207940 ACCAGCTAACATCATAATGATGG - Intergenic
1098585921 12:72154429-72154451 GCCAGCTAAAATCATAATGACGG - Intronic
1098692975 12:73512685-73512707 CACAGCTAACATTATATTCAGGG + Intergenic
1098804332 12:75003465-75003487 CACAGCCAATATCATACTGAAGG - Intergenic
1099235505 12:80078711-80078733 ACCAGCTAACATCATAATGACGG - Intergenic
1099430782 12:82582852-82582874 CACAGCTAATCTCATAAATGAGG + Intergenic
1100942198 12:99736141-99736163 CACAGCTAACATCATACTGATGG + Intronic
1102073012 12:110037305-110037327 CACTACTATCATCATCATGGTGG - Intronic
1103255229 12:119536449-119536471 ACCAGCTAACATCATAATGACGG - Intronic
1104221719 12:126791002-126791024 CACAGATAACTTCATCATGCTGG - Intergenic
1104495764 12:129236836-129236858 CACAACTAACATCATACTCAAGG - Intronic
1105952050 13:25238003-25238025 CACAGCTAACACCATACTCAAGG + Intergenic
1107225149 13:38040022-38040044 ACCAGCTAACATCATAATGACGG - Intergenic
1108890224 13:55248921-55248943 CACAGATAGCATCATACTGAAGG + Intergenic
1109356575 13:61236884-61236906 CACAGCTAACATCATATTGAAGG + Intergenic
1109567445 13:64135734-64135756 CACAGCCAACATAATACTGAAGG + Intergenic
1109806836 13:67454396-67454418 ACCAGCTAACATCATAATGACGG + Intergenic
1111420705 13:88006569-88006591 CACAGCCAATATCATACTGAAGG - Intergenic
1111823255 13:93238699-93238721 CACAGTGAACATCATACTGAAGG - Intronic
1112411804 13:99171025-99171047 ACCAGCTAACATCATAATGACGG - Intergenic
1112854298 13:103747233-103747255 CACAGCCAATATCATACTGAAGG - Intergenic
1112899773 13:104344386-104344408 ACCAGCTAACATCACAATGACGG - Intergenic
1112948372 13:104959314-104959336 CACAGCCAATATCATACTGAAGG - Intergenic
1113673445 13:112191077-112191099 CACTACTAAAAACATAATGGTGG - Intergenic
1114205296 14:20565334-20565356 CACAGCTAATATCATACTGATGG + Intergenic
1114685603 14:24528032-24528054 ACCAGCTAACATCATAATGATGG + Intergenic
1114869895 14:26643841-26643863 ACCAGCTAGCATCATAATGATGG - Intergenic
1114878830 14:26758380-26758402 CACAGCTGACATTATACTCGAGG + Intergenic
1115134556 14:30093237-30093259 CACAGCTAGTATCATACTGAAGG + Intronic
1115391021 14:32855196-32855218 ACCAGCTAACATCATAATGACGG - Intergenic
1115911791 14:38265049-38265071 CACAGCCAATATCATACTGAAGG - Intergenic
1116401580 14:44514222-44514244 ACCAGCTAACATCATAATGATGG - Intergenic
1116668741 14:47813768-47813790 CACAGCCAACATTATACTGAAGG - Intergenic
1116893938 14:50297136-50297158 CACAGCTAACATCATACTTAAGG + Intronic
1117264607 14:54074013-54074035 CACAGCCAATATCATACTGAAGG - Intergenic
1117301010 14:54428077-54428099 CACAGCTGAAAGCTTAATGGCGG + Intronic
1117452765 14:55866668-55866690 TACAGCTAACATCATACTTAAGG - Intergenic
1117751864 14:58931767-58931789 CACAGCTAACATAATCAATGGGG - Intergenic
1118963117 14:70553819-70553841 CACAGCTAGCATCATGAATGGGG + Intergenic
1120064941 14:80029652-80029674 ACCAGCTAACATCATAATGACGG + Intergenic
1120069875 14:80090622-80090644 ACCAGCTAACGTCATAATGACGG + Intergenic
1120400079 14:84020000-84020022 CACAGCTAGTATCATACTGAAGG + Intergenic
1124451232 15:29793213-29793235 CACAGCTAGTATCATGAGGGGGG - Intronic
1124502143 15:30237934-30237956 CACAGCCAACATAATACTGAAGG - Intergenic
1124741420 15:32300718-32300740 CACAGCCAACATAATACTGAAGG + Intergenic
1124850483 15:33333576-33333598 CACAGCCAACATCATACTGAAGG + Intronic
1125445416 15:39749691-39749713 CACAGTTAACATCATAACCAAGG + Intronic
1126887049 15:53162306-53162328 CACTGCCTATATCATAATGGAGG - Intergenic
1128241545 15:66104793-66104815 CACATCTAACAGCATCATGGGGG + Intronic
1128941652 15:71792330-71792352 CACAGCTTACATCAGACTGCTGG - Intergenic
1129444956 15:75610490-75610512 CACAGCTGACAGGATGATGGGGG + Intronic
1129568548 15:76652757-76652779 CACAGCCAACATCATACTGAAGG + Intronic
1129572109 15:76699373-76699395 CACAGCCAACATCATAGTGGAGG - Intronic
1129627917 15:77224295-77224317 CACAGATACTATCATAATGCAGG + Intronic
1132412575 15:101594658-101594680 CACAGCCAACATTATACTGAAGG - Intergenic
1133951294 16:10395807-10395829 CACGGTTAACATCATAGTGGAGG + Intronic
1134767411 16:16773032-16773054 ACCAGCTAGCATCATAAAGGCGG - Intergenic
1136261004 16:29075783-29075805 CAGAGCTTACAGCATATTGGGGG + Intergenic
1136602681 16:31305567-31305589 CACAGCCAACTTCATATTGAAGG - Intronic
1136650910 16:31669576-31669598 CACGGCCAACATCATACTGAAGG - Intergenic
1136653199 16:31691207-31691229 CACAGCCAATATCATACTGAAGG + Intergenic
1137347843 16:47681805-47681827 ACCAGCTAACATCATAATGACGG - Intronic
1139040699 16:62996384-62996406 ACCAGCTAACATCATAATGACGG - Intergenic
1139048957 16:63099357-63099379 ACCAGCTAACATCATAATGACGG - Intergenic
1139218606 16:65155080-65155102 GAGAGCTAACATCAGAATGCAGG - Intergenic
1140027781 16:71306586-71306608 CACAGCCAATATCATACTGAAGG - Intergenic
1140148483 16:72336332-72336354 TACAGCTAACATCATACTTAAGG - Intergenic
1142948199 17:3453529-3453551 CACAGCTAACATCATAATGGGGG + Intronic
1144721472 17:17473529-17473551 CAACACTCACATCATAATGGTGG - Intergenic
1144898925 17:18565540-18565562 AACAGCTAAAAACATCATGGCGG + Intergenic
1145133451 17:20380179-20380201 AACAGCTAAAAACATCATGGCGG - Intergenic
1145688135 17:26699108-26699130 ACCAGCTAACATCATAACGACGG - Intergenic
1145963930 17:28903536-28903558 CACACCTAACTTCAGAAGGGAGG - Intergenic
1149817831 17:59744002-59744024 TACAGCTAACATCATACTTAAGG - Intronic
1150867372 17:68867528-68867550 CACAGGTAACACCATGATGTAGG - Exonic
1153102769 18:1493007-1493029 CACAGCCAACATCACGATGATGG - Intergenic
1153454389 18:5263795-5263817 ACCAGCTAACATCATAATTATGG + Intergenic
1153489689 18:5634376-5634398 AAAAGTTAACATCATAATGGTGG - Intergenic
1153717491 18:7865296-7865318 CACAGCCAATATCATACTGAAGG - Intronic
1154407994 18:14113590-14113612 CACAGCTACAATAAAAATGGAGG + Intronic
1155427178 18:25718556-25718578 ACCAGCTAAAATCATAATGATGG + Intergenic
1155477882 18:26253189-26253211 CACAGATAACATCATACTTTTGG - Intronic
1155747746 18:29381612-29381634 CAGAGTTAATATGATAATGGTGG + Intergenic
1156406938 18:36791649-36791671 CACAATTAACTCCATAATGGAGG + Intronic
1156578191 18:38344159-38344181 CACAGCCAACATCATACTGAAGG + Intergenic
1157123225 18:44931974-44931996 AGCAGCTAACATCATAATGACGG - Intronic
1157336665 18:46744171-46744193 ACCACCTAACATCATAATGACGG + Intronic
1157854732 18:51094922-51094944 CACAGCCAATATCATACTGAGGG - Intergenic
1158034877 18:53014851-53014873 CACAGATATCATCATAAAGTAGG - Intronic
1158368420 18:56768122-56768144 CAAATCTAACACCATCATGGTGG - Intronic
1164410267 19:27997098-27997120 CACAACTAACATCGTACTGATGG + Intergenic
1164498942 19:28796007-28796029 CACAGTTAACATAATAATCAGGG - Intergenic
1166260460 19:41636725-41636747 ACCAGGTAACATCATAATGATGG - Intronic
1168188494 19:54718977-54718999 CACAGCCAACATCATATTGATGG + Intergenic
925006957 2:451063-451085 CAAAGCAAAAATCATTATGGAGG - Intergenic
927222301 2:20724538-20724560 AAGAGCTGACATCATGATGGAGG + Intronic
927526446 2:23745570-23745592 CACAGCTAACATCAGGTTGGGGG - Intergenic
928476898 2:31636587-31636609 CACAGCTAACATCATACTCATGG - Intergenic
928949115 2:36798957-36798979 CACAGCAATCAGCAGAATGGGGG - Intronic
929490780 2:42394319-42394341 CACAGCAAACAGCCTAAGGGTGG + Intronic
930269938 2:49244269-49244291 ACCAGCTAGCATCATAATGATGG + Intergenic
930373011 2:50528568-50528590 ACTAGCTTACATCATAATGGAGG + Intronic
931846411 2:66208290-66208312 ACCAGCTAACATCATCATGACGG + Intergenic
932266569 2:70372363-70372385 CACAGCCAACATTATACTGTGGG - Intergenic
932636744 2:73396087-73396109 CACAACTAACATCATACTCGGGG - Intronic
932715482 2:74098326-74098348 CACAGCTCTAATCATATTGGGGG + Intronic
932867824 2:75364957-75364979 CATAGCCAATATCATAATGAAGG - Intergenic
935928500 2:108096774-108096796 CACAGCTAACATCATACTCAAGG + Intergenic
937165082 2:119806185-119806207 ACCAGCTAACATCATAACGATGG + Intronic
937420582 2:121751606-121751628 TACAGCTAACATCATAGTTAAGG + Intronic
937745577 2:125409050-125409072 CACCACTAACATCCTAAAGGTGG + Intergenic
939055749 2:137362340-137362362 ACCAGCTAACATCATAATGATGG + Intronic
940732623 2:157411147-157411169 TACAGCTAATATTATAATGGTGG - Intergenic
940747320 2:157582600-157582622 CACAGTTAACATCATACTTAAGG + Intronic
941347115 2:164383692-164383714 CACAGCTAACATCATGTTAGTGG - Intergenic
942405091 2:175645861-175645883 TACAGCTAACATCATATTAATGG - Intergenic
943237597 2:185342216-185342238 CACAGCTATCATCATATTCAAGG + Intergenic
943352698 2:186813964-186813986 ACCAGCTAGCATCATAATGTCGG + Intergenic
944018166 2:195069632-195069654 CACAGCTAATATCGTACTGAAGG - Intergenic
944030793 2:195232332-195232354 CACAGCCAATATCATACTGAAGG + Intergenic
944347613 2:198686888-198686910 ACCAGCTAGCATCATAATGACGG + Intergenic
945409401 2:209490383-209490405 ACCAGGTAACATCATAATGATGG + Intronic
945576005 2:211529874-211529896 TACAGCTAGCATCATACTGAAGG + Intronic
945652690 2:212584426-212584448 ACCAGCTAACATCATAATGATGG - Intergenic
945666930 2:212754882-212754904 ACCAGCTAACATCATAATGTCGG + Intergenic
945945431 2:215990502-215990524 ACCAGCTAGCATCATAATGATGG + Intronic
947335505 2:229078506-229078528 CACAGCTAATATCATACTGAAGG - Intronic
1168999406 20:2156251-2156273 TACAGCTAACATCATACTAACGG + Intronic
1169960123 20:11150817-11150839 AGCAGCTAGCATCATAATGACGG - Intergenic
1170384610 20:15802301-15802323 CACAGCTGGCATCATACTGAAGG - Intronic
1170490876 20:16872973-16872995 TACAGCTAACAGGATAATGAAGG - Intergenic
1171422606 20:25027650-25027672 CACAGCTAACATCATATTAATGG + Intronic
1171441613 20:25168031-25168053 ACCAGCTAGCATCATAATGACGG + Intergenic
1171720484 20:28557561-28557583 CACAGCTACCATCATTATTAAGG + Intergenic
1173032115 20:39371359-39371381 CACAGCCAATATCATACTGAAGG + Intergenic
1173770801 20:45655463-45655485 CACAGCCAATATCATACTGAAGG + Intronic
1176284066 20:64333669-64333691 CACAGCCAACATTATACTGAAGG - Intergenic
1176743879 21:10633174-10633196 ACCAGCTAACATCACAATGACGG + Intergenic
1176978176 21:15348499-15348521 CACAGTTAACATCATACTGAAGG + Intergenic
1177526741 21:22302729-22302751 CACAGCAAACATCATGCTGAAGG + Intergenic
1177951135 21:27539138-27539160 CACAGCCAACATCGTATTGAAGG + Intergenic
1180370867 22:12035394-12035416 ACCAGCTAACATCATAATGACGG - Intergenic
1180939762 22:19651908-19651930 CACAGCTAACATCATAATGGTGG + Intergenic
1181411153 22:22720731-22720753 CACAGCTAGCATGATAATATGGG - Intergenic
1182000858 22:26918641-26918663 CACAGTTAAAATCAAAATGATGG - Intergenic
1185147253 22:49145380-49145402 CACATTCAACATCATACTGGAGG + Intergenic
949301360 3:2587628-2587650 CATAGCTGAAATCATAAGGGAGG - Intronic
949816700 3:8066654-8066676 ACCAGCTAACATCATAATGACGG - Intergenic
949898339 3:8788271-8788293 CACAGCTAACCTCATATTAATGG - Intronic
950368643 3:12508081-12508103 CAGAGCTAGCATCAGTATGGAGG + Intronic
951042502 3:18003726-18003748 ACCAGCTAACATTATAATGACGG - Intronic
951423480 3:22515283-22515305 CACAGCTAGTATCATATTGAAGG + Intergenic
951497982 3:23351343-23351365 ACCAGCTAACATCATAATGACGG + Intronic
951751408 3:26040658-26040680 ACCAGCTAACATCATAATGACGG - Intergenic
952250893 3:31652709-31652731 CATAGCTAACATCATACTAATGG + Intergenic
952426293 3:33178077-33178099 TACAGCTAACATCATGATTAAGG - Intronic
954488299 3:50875411-50875433 CATAGCTAATATCATACTGAAGG - Intronic
954984652 3:54779061-54779083 CAAAAGTAACATCATAACGGTGG - Intronic
955099746 3:55835633-55835655 CACAGCCAATATCATACTGAAGG + Intronic
955135816 3:56217022-56217044 CACAGCCAATATCATACTGAAGG + Intronic
955852584 3:63236970-63236992 TACAGCTAACATCATACTTATGG - Intronic
955895071 3:63690398-63690420 CACATCTACCATCAGAATAGAGG - Intergenic
956323854 3:68028680-68028702 AACAGGTAACATGACAATGGAGG - Intronic
956976003 3:74580750-74580772 TACAACTAACATCATACTAGTGG + Intergenic
956999166 3:74864581-74864603 GACACTGAACATCATAATGGGGG - Intergenic
957806655 3:85156719-85156741 CACAGCCAATATCATACTGAAGG + Intronic
957871503 3:86095053-86095075 ACCAGCTAATATCATAATGACGG + Intergenic
958462988 3:94422324-94422346 CACAGCCAACATCATACTGAGGG + Intergenic
959170650 3:102840304-102840326 ACCAGCTAGCATCATAATGATGG - Intergenic
959673610 3:109008695-109008717 TATAGTTATCATCATAATGGAGG - Intronic
959764695 3:110011694-110011716 CACAGCCAATATCATACTGAAGG + Intergenic
960016274 3:112892313-112892335 AACAGCTAACATCATATTAATGG + Intergenic
960612213 3:119565281-119565303 CACAGCCAATATCATACTGATGG - Intergenic
960686002 3:120294371-120294393 CACAGCCAACATCATACTGAAGG + Intergenic
960688459 3:120317787-120317809 CACAGCCAACATTATACTGAAGG + Intergenic
960841196 3:121961403-121961425 CACAGCTAGTATCATACTGAAGG + Intergenic
962131603 3:132684209-132684231 CACAGCAAACTTAATATTGGTGG + Intronic
962237626 3:133720209-133720231 CATAGCTAACATCATACTGAAGG - Intergenic
962821397 3:139050677-139050699 CACAGCTAACATTATACTGAAGG - Intronic
962857514 3:139361351-139361373 CACAGTTAACAGAATAATGTTGG - Intronic
963820471 3:149886707-149886729 CACAGCTAACATCATACTTCAGG - Intronic
963980469 3:151530821-151530843 ACCAGCTAGCATCATAATGACGG + Intergenic
964804419 3:160591996-160592018 CATAGCTAGCATCATAATGAAGG + Intergenic
964963868 3:162464828-162464850 CACAGCCAACATCATACTGAAGG + Intergenic
966574255 3:181481657-181481679 CACAGCCAATATCATACTGATGG + Intergenic
967295866 3:187964174-187964196 CACAGCTCACATTGTAATGCTGG - Intergenic
967655859 3:192047735-192047757 CACAGCTAGTATCATACTGAAGG + Intergenic
967750136 3:193104309-193104331 CACAGCCAACAATATAATGAAGG - Intergenic
967757053 3:193181504-193181526 GCTAGCTAACATCATAATGAAGG + Intergenic
967779138 3:193417565-193417587 CACAGCTAACATCATACTCAAGG + Intronic
968246172 3:197151359-197151381 AACAGCTAACATAATAATTATGG - Intronic
970217136 4:13771326-13771348 CACAGCCAACATAATACTGATGG - Intergenic
970655029 4:18221419-18221441 CACAGCCAATATCATACTGAAGG - Intergenic
970861937 4:20714534-20714556 ACCAGCTAATATCATAATGACGG - Intronic
971517012 4:27499834-27499856 CACAGCCAATATCATATTGAAGG + Intergenic
972386987 4:38576741-38576763 CACAGCAAGCTTTATAATGGAGG + Intergenic
972411242 4:38797047-38797069 CACAGCCAACACCAGCATGGTGG + Exonic
972414773 4:38827674-38827696 CACAGCCAACACCAGCATGGTGG + Exonic
972419711 4:38875767-38875789 CACAGCTAACATCATACCGAAGG - Intronic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
972820690 4:42698402-42698424 CACAGCCAATATCATACTGAAGG - Intergenic
973113381 4:46423754-46423776 CACAGCCAACATAATACTGATGG - Intronic
973559490 4:52121015-52121037 ACCAGCTAACATCATAGTGACGG - Intergenic
974871950 4:67654643-67654665 ACCAGCTAACATCATAATGATGG + Intronic
975203456 4:71617910-71617932 ACCAGCTAACATCATAATGAAGG + Intergenic
975449485 4:74507422-74507444 ACCAGCTAACATCGTAATGATGG + Intergenic
975630123 4:76392519-76392541 CACAGCTAGTATCATACTGAAGG + Intronic
975893741 4:79060999-79061021 CATAGCTAACTTCATGAGGGTGG + Intergenic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
977144148 4:93414375-93414397 AACAGCTGACATCATCATAGTGG + Intronic
977386007 4:96340205-96340227 CACAGTTTACTTCAGAATGGAGG + Intergenic
977404618 4:96579936-96579958 AACAGCTAACATCATAATGATGG - Intergenic
977632570 4:99259582-99259604 CACAGCCAATATCATACTGATGG - Intergenic
977881999 4:102215644-102215666 CACAGCTCATCTCATAATGTAGG + Intergenic
978193125 4:105939146-105939168 CAAAGCTGACATGCTAATGGGGG + Intronic
978626505 4:110691697-110691719 ACCAGCTAACATCATAATGACGG - Intergenic
978674918 4:111301207-111301229 CACAGCCAACATGATACTGATGG - Intergenic
978678389 4:111347489-111347511 CATAGCTAACATGATACTGAAGG - Intergenic
979006962 4:115311333-115311355 CACAGCCAACATCATACTGAAGG + Intergenic
979298996 4:119065939-119065961 ACCAGCTAACATCATAATGACGG - Intergenic
979947667 4:126853804-126853826 CAGTTCCAACATCATAATGGAGG - Intergenic
979995753 4:127428858-127428880 CACAGCCAACATAATACTGAAGG + Intergenic
980476153 4:133319524-133319546 CACAGCTAACAAAATAAAAGGGG - Intergenic
980540337 4:134185567-134185589 CACAGCCAATATCATACTGAAGG + Intergenic
980544378 4:134239073-134239095 CACAGCCAACATTATACTGAAGG + Intergenic
980936716 4:139232795-139232817 GACAGTTAAAATGATAATGGGGG + Intergenic
981178007 4:141704164-141704186 AACAGCTAACATCATACTGAAGG - Intronic
981353202 4:143756068-143756090 CACAGCCAATATCATACTGCAGG + Intergenic
981501799 4:145459601-145459623 ACCAGCAAACATCATAATGACGG + Intergenic
981742533 4:148017611-148017633 CACAGCTCTCATTATAATGTTGG - Intronic
981800429 4:148648955-148648977 AAAAGCTAATATTATAATGGTGG - Intergenic
982909007 4:161116278-161116300 ACCAGCTAATATCATAATGACGG - Intergenic
983598602 4:169498439-169498461 ACCAGCTAACATCATAATGAAGG - Intronic
983820000 4:172181478-172181500 CACAGCCAATATCATACTGAAGG + Intronic
984463086 4:180059566-180059588 CACAGGGAACATCATAATGAAGG - Intergenic
984487524 4:180389925-180389947 TACAGATAACATTATAATGAGGG + Intergenic
984729140 4:183050336-183050358 CACAGCTAACATCATAATAAGGG + Intergenic
984835361 4:184014772-184014794 CACAGCCAACATATTAATAGTGG - Intronic
985232319 4:187833526-187833548 CACAGCTAACATTATACTTAAGG - Intergenic
985581532 5:698194-698216 CACAGCCAACATCAGAATTAAGG + Intergenic
985596159 5:789522-789544 CACAGCCAACATCAGAATTAAGG + Intergenic
986472119 5:8086325-8086347 CACAGCCAATATCATACTGAAGG - Intergenic
987465029 5:18261714-18261736 ACCAGCTAACATCATAATGACGG + Intergenic
988063868 5:26209332-26209354 CACAGCCAACATCATACTGAAGG + Intergenic
988202105 5:28082510-28082532 CACAGCTAAAATCATACTAATGG - Intergenic
988309542 5:29540189-29540211 ACCAGCTAACATCATAATGAAGG - Intergenic
988401437 5:30766048-30766070 CACAGCTATCATCATTATGTCGG - Intergenic
988512101 5:31873463-31873485 CACAGCTCACATGATTGTGGAGG + Intronic
989044454 5:37260894-37260916 CACAGCCAATATCATACTGAAGG - Intergenic
989304141 5:39932101-39932123 CACAAATAGCATCATAAAGGTGG + Intergenic
989418439 5:41207334-41207356 ACCAGCTAACATCATAATGACGG + Intronic
989452991 5:41608765-41608787 AACTGGTAACATCATAATGATGG - Intergenic
989492092 5:42069377-42069399 CACAGCTAGTATCATACTGGGGG - Intergenic
989522260 5:42416349-42416371 ACCAGCTAACATCATAATGATGG - Intergenic
989552563 5:42752785-42752807 CACAGCTAACATTTTGATGGAGG + Intergenic
989670793 5:43914333-43914355 ACTAGCTAACATCATAATGACGG + Intergenic
989817356 5:45752057-45752079 CTCAGGAAACATCATCATGGTGG + Intergenic
989847091 5:46158234-46158256 CACAGCCAATATCATACTGAAGG - Intergenic
989977091 5:50600146-50600168 ACCAGCTAACATCATAATGATGG - Intergenic
991097499 5:62754486-62754508 ACCAGCTAACATTATAATGCAGG + Intergenic
992078091 5:73209175-73209197 ACCAGCTAGCATCATAATGATGG + Intergenic
992493008 5:77263721-77263743 TACAGCTAATTTCCTAATGGAGG + Intronic
992516896 5:77502973-77502995 ACCAGCTAACATCATAATGATGG + Intronic
992936992 5:81718029-81718051 CACACCTAGCATCCTAAGGGCGG - Intronic
993627226 5:90240341-90240363 ACCAGCTAGCATCATAATGACGG + Intergenic
993888480 5:93444157-93444179 ACCAGCTAACATCATAATGATGG + Intergenic
994004943 5:94827003-94827025 ACCAGCTAGCATCATAATGCAGG - Intronic
994070735 5:95599072-95599094 CAGAGCTAACATTCTAATGTGGG - Intronic
994233321 5:97334435-97334457 ACCAGCTAGCATCATAATGATGG - Intergenic
994359071 5:98829508-98829530 ACCAGCTAACATCATGATGATGG + Intergenic
994484925 5:100379481-100379503 CACAGACCACATCATGATGGCGG + Intergenic
994538294 5:101059795-101059817 ACCAGCTAACATCATAATGACGG - Intergenic
994888562 5:105599219-105599241 ACCAGCTAACATCATAATGACGG + Intergenic
995116712 5:108488786-108488808 CACAGCTAACATCATACTGAGGG + Intergenic
995204120 5:109459347-109459369 ATCAGCTAACATCATAATGACGG + Intergenic
995278234 5:110302923-110302945 CACAGCTAATATTATACTGAAGG - Intronic
995309497 5:110694411-110694433 ACCAGCTAACATCATAATGACGG + Intronic
995330045 5:110936072-110936094 ACCAGCTAACATCATAATGACGG + Intergenic
995427090 5:112037399-112037421 CACAGCCAATATCATACTGAAGG + Intergenic
996276962 5:121678603-121678625 CACAGCCAATATCATACTGAAGG - Intergenic
996348515 5:122513653-122513675 ACCAGCTAACATCATAATGACGG - Intergenic
996686883 5:126292589-126292611 ACCAGCTAACATCATAATGATGG + Intergenic
996813131 5:127542909-127542931 ACCAGCTAACATCATAATGATGG - Intronic
997168735 5:131691892-131691914 TACAGCTAACATCATACTTATGG + Intronic
998536439 5:142935882-142935904 TACCGCTAACATCATAATTAGGG + Intronic
998563771 5:143197396-143197418 AATAGCTAACATCAAAATGCTGG - Intronic
999089137 5:148920255-148920277 CACAGCCAATATCATACTGAAGG - Intergenic
1001849554 5:174951761-174951783 AAGAGCTTACATCCTAATGGGGG + Intergenic
1002396019 5:178955310-178955332 TACTGCTAACATCATACTGATGG - Intronic
1003225562 6:4202550-4202572 ACCAGCTAACACCATAATGATGG - Intergenic
1005304823 6:24503594-24503616 CACACCTAACATCATCACAGAGG - Intronic
1005395014 6:25372853-25372875 CACAGCCAACATCATACTGAAGG - Intronic
1005689746 6:28291976-28291998 TACAGCTAACATCAAACTGAAGG + Intronic
1006048952 6:31325435-31325457 CACAGCGAGCATCATACTGATGG + Intronic
1007001076 6:38313490-38313512 CACAGCTAGTATCATACTGATGG - Intronic
1008207737 6:48683997-48684019 CACAGCCAATATCATAATAATGG + Intergenic
1008491824 6:52094983-52095005 ACCAGCTAACATCATAATGATGG - Intergenic
1008864755 6:56196251-56196273 CACAGCTAACATTATACTAATGG + Intronic
1009332592 6:62442145-62442167 CACAGCCAACATCATACTGAAGG - Intergenic
1010556001 6:77280523-77280545 CACAGCCAACATTATACTGAAGG + Intergenic
1010747447 6:79579756-79579778 ACCAGCGAACATCATAATGACGG + Intergenic
1011004974 6:82634151-82634173 ACCAGCTAACATCATAATAATGG + Intergenic
1011303859 6:85905136-85905158 CACAGCCAATATCATACTGATGG - Intergenic
1011523975 6:88242589-88242611 CACAGCCAATATCATAGTGATGG - Intergenic
1011762141 6:90578702-90578724 GAGAGCTAATATCAGAATGGGGG - Intronic
1012232105 6:96772115-96772137 CACAGCCAATATCATACTGAAGG + Intergenic
1012995784 6:105972423-105972445 CACAGCTAACATCATACTCAAGG - Intergenic
1013256264 6:108389412-108389434 ACCAGTTAACATCATAATGACGG - Intronic
1013926469 6:115479079-115479101 ACCAGCTAACATCATAATGATGG - Intergenic
1014279055 6:119420053-119420075 ACCAGCTAGCATCATAATGATGG + Intergenic
1014462281 6:121710482-121710504 CACAGCTAACATCATACTTAAGG + Intergenic
1014613922 6:123579251-123579273 CACAGCCAACGTCATACTGATGG - Intronic
1015728770 6:136326606-136326628 TACAGCTAGCATCAGGATGGGGG + Intergenic
1016227579 6:141758984-141759006 TACAGCTAACATCTTAATAGTGG + Intergenic
1018073078 6:160183486-160183508 ACCAGCTAACATCATCATGACGG + Intronic
1018168429 6:161123338-161123360 CACAGCCAACATTATACTGAAGG - Intergenic
1018511288 6:164527109-164527131 CTCAGCAAACATAATTATGGAGG - Intergenic
1018781805 6:167075095-167075117 TACAGCTAACATGATGGTGGAGG + Intergenic
1019071519 6:169349986-169350008 CACAGCCAATATCATACTGAAGG - Intergenic
1019692893 7:2426608-2426630 TACAGCTAACCTCATAATTAAGG - Intronic
1021318874 7:19186521-19186543 CACTGCTAACATCATAATGAAGG + Intergenic
1021502094 7:21343383-21343405 ACCAGCTAGCATCATAATGACGG - Intergenic
1021893406 7:25210164-25210186 CACAGCTAACATAATCAATGGGG - Intergenic
1023194135 7:37616091-37616113 ACCAGCTAACATCATAATGACGG - Intergenic
1024187472 7:46966577-46966599 TACAGCTAACATTATAATTAAGG + Intergenic
1024499403 7:50087542-50087564 CACAGATAACATCATACTTAAGG + Intronic
1024905050 7:54368221-54368243 TACAGCTAACAATCTAATGGAGG + Intergenic
1024994749 7:55264525-55264547 CACAACTAACATCATACTCAAGG + Intergenic
1025594038 7:62901948-62901970 ACCAGCTAGCATCATAATGACGG + Intergenic
1027627124 7:80560052-80560074 CACAGCCAACATTATACTGAAGG - Intronic
1027991352 7:85365688-85365710 CACAGCTAACATCATACTTAAGG - Intergenic
1028329265 7:89568479-89568501 CACAGCCAGCATCTTAATGAAGG + Intergenic
1028486125 7:91359497-91359519 CAGAGATAGCAGCATAATGGAGG + Intergenic
1028514612 7:91663184-91663206 CACGGCTAACATCATACTTAAGG - Intergenic
1028620211 7:92817529-92817551 TACAGCTAACATCATACTTTAGG + Intronic
1028633085 7:92957383-92957405 ACCAGCTAACATGATAATGATGG + Intergenic
1028815927 7:95144622-95144644 CACAGCTAACATCATACTAACGG + Intronic
1028992134 7:97060519-97060541 CACAGCTAATATCATATTGAAGG + Intergenic
1029220708 7:98987784-98987806 CACAGCTAACATCATACTCAAGG - Intronic
1029956814 7:104649074-104649096 CTCAGCTAACATCATGATCCAGG + Intronic
1030370115 7:108689905-108689927 CACAGCTAGTATCATACTGATGG - Intergenic
1030475975 7:110034162-110034184 ACCAGCTAACATCATAAGGACGG - Intergenic
1030500437 7:110352889-110352911 CACAGCCAATATCATACTGAAGG - Intergenic
1030501092 7:110359945-110359967 CACAGATAACATCATATCAGTGG - Intergenic
1030725222 7:112918554-112918576 ACCAGCTAACATCATAATGACGG + Intronic
1030882190 7:114894101-114894123 CACAGCCAACATCATACTGAAGG - Intergenic
1031131079 7:117833982-117834004 GACAGACAACATCTTAATGGTGG + Intronic
1031905236 7:127453054-127453076 ACCAGTTAACATCATAATGATGG + Intergenic
1032775273 7:135106335-135106357 CACAGCCAACATCGTACTGTGGG - Intronic
1032971868 7:137174174-137174196 CACATCTAAGATTATATTGGAGG + Intergenic
1033640076 7:143254434-143254456 CACAGCTAACATCATACTCAAGG + Intronic
1033813895 7:145049869-145049891 CACAGCTAGTATCATACTGAAGG - Intergenic
1034142955 7:148839510-148839532 CAGAAATAACATCAAAATGGGGG + Intronic
1034224605 7:149473084-149473106 AGCATCTAACATCATAAAGGTGG - Exonic
1034280229 7:149848536-149848558 CACTGCTAACATCATAATGTTGG + Intronic
1034336274 7:150325431-150325453 CACAGCTGACAACACATTGGAGG - Intronic
1034369047 7:150578510-150578532 ACCAGCTAACATCATAATGACGG - Intergenic
1034621481 7:152460646-152460668 AGCAGCTCACATCTTAATGGTGG + Intergenic
1035493667 7:159302394-159302416 CACAGCCAATATCATACTGAAGG + Intergenic
1035835465 8:2746679-2746701 CACAGCTAACATCATACTGAAGG + Intergenic
1035900344 8:3452427-3452449 CACAGCCAATATCATACTGAAGG - Intronic
1037227930 8:16617659-16617681 CACATTTAACATTATACTGGAGG - Intergenic
1037601461 8:20399059-20399081 CACAGCTAACATCATACTCAAGG - Intergenic
1037668333 8:20992291-20992313 CACAGGTAACATTATATTAGTGG + Intergenic
1037687087 8:21150082-21150104 CACCTCTAACATCATACTGAAGG + Intergenic
1038083092 8:24162567-24162589 ACCAGCTAGCATCATAATGACGG - Intergenic
1038640972 8:29326485-29326507 CACTGCTAATATCATATTGGGGG - Intergenic
1038997586 8:32942221-32942243 CACAGCTAACATCATATAAATGG - Intergenic
1039108285 8:34013443-34013465 CACAGCAAAAACCATATTGGTGG - Intergenic
1039787236 8:40844552-40844574 ATCAGCTCACATGATAATGGAGG - Intronic
1040376665 8:46831950-46831972 ACCAGGTAACATCATAATGACGG + Intergenic
1040431547 8:47347982-47348004 ACCAGCTAACATCATAATGACGG - Intronic
1040438843 8:47420649-47420671 ACCAGGTAACATCATAATGACGG - Intronic
1041202375 8:55462581-55462603 ACCAGCTAACATCATAATGACGG + Intronic
1041286158 8:56264420-56264442 ACCAGCTAACATCATAACGATGG - Intergenic
1042213189 8:66402272-66402294 CACAGCTAACAAGAGCATGGGGG - Intergenic
1042479701 8:69289611-69289633 CACAGCCACCATCATATTGTAGG + Intergenic
1042599358 8:70482853-70482875 CCCAGCCAACATCATCATGTTGG - Intergenic
1043235689 8:77862696-77862718 CACAGCTAGTATCATACTGAAGG + Intergenic
1044455133 8:92384712-92384734 ACCACCTAACATCATAATGACGG - Intergenic
1044509249 8:93056534-93056556 ACCAGCTAGCATCATAATGATGG - Intergenic
1045349815 8:101328562-101328584 CACAGAGAACATCATACTGCTGG - Intergenic
1045410954 8:101918361-101918383 CACAGCGAATATCATACTGAAGG + Intronic
1045788900 8:105957757-105957779 ACCAGCTAACATCATAATGACGG + Intergenic
1045933319 8:107652257-107652279 ACCAGCTAGCATCATAATGATGG - Intergenic
1046166260 8:110440257-110440279 CACAGCCAACATTATACTGAAGG + Intergenic
1046433806 8:114162478-114162500 GACAGCTAACAACATAGTGAAGG + Intergenic
1046450042 8:114377104-114377126 CACAGCCAACATCACACTGAAGG + Intergenic
1046972314 8:120236652-120236674 ACCAGCTAGCATCATAATGACGG - Intronic
1047086334 8:121520411-121520433 TACAGCTAACATCATACTTAAGG + Intergenic
1048930944 8:139315094-139315116 CACAGCTAACAGAAGCATGGTGG + Intergenic
1049064957 8:140305900-140305922 CACAGCTAACTGCAGAATGCGGG + Intronic
1050407927 9:5329363-5329385 ACCAGCTAACATCATAATGATGG + Intergenic
1050645663 9:7716920-7716942 CACAGCCAATATCATACTGAAGG + Intergenic
1051045530 9:12868829-12868851 ACCAGCTAGCATCATAATGACGG - Intergenic
1051941114 9:22506898-22506920 ACCAGCTAACGTCATAATGATGG - Intergenic
1052317333 9:27129086-27129108 CACAGCCAATGTCATAATGAAGG - Intronic
1053116257 9:35505872-35505894 CACAGCTAACATCATTCTTAAGG + Intronic
1053654293 9:40199594-40199616 CACAGCTAACATAATCAAGAAGG - Intergenic
1054339519 9:63845461-63845483 ACCAGCTAACATCATAATACAGG + Intergenic
1054366408 9:64345811-64345833 CACAGCTAACATAATCAAGAAGG - Intergenic
1054674037 9:67835552-67835574 CACAGCTAACATAATCAAGAAGG - Intergenic
1054753985 9:68938626-68938648 ACCAGCTAGCATCATAATGACGG - Intronic
1054931925 9:70644164-70644186 CAGAGCTTACATCCTACTGGTGG + Intronic
1055148563 9:72966226-72966248 AACAGCTAACATTATAATAAAGG - Intronic
1055380838 9:75705133-75705155 ACCAGCTAACATCATAATGACGG - Intergenic
1055829788 9:80364699-80364721 CACAGCCAACATCATACTGAAGG + Intergenic
1056412537 9:86345255-86345277 CACAGCTAAAATGAGAAGGGAGG - Intronic
1058240733 9:102554844-102554866 GACAGCCAACATCATACTGAAGG + Intergenic
1058366843 9:104219191-104219213 ACCAGCTAACATCACAATGACGG - Intergenic
1060164749 9:121402045-121402067 ACCAGCTAACATCATACTGAAGG + Intergenic
1060314137 9:122492819-122492841 CACAGCCAACATTATACTGAAGG - Intergenic
1060323095 9:122584341-122584363 CACAGCTAACATCATACTCTAGG + Intergenic
1060731865 9:126043390-126043412 CACAGCTAACATCATACTTAAGG - Intergenic
1061418340 9:130460205-130460227 CACAGCTAAGATGATGATGGAGG + Intronic
1203384755 Un_KI270438v1:13767-13789 ACCAGCTAACATCATAAAGACGG + Intergenic
1203651652 Un_KI270751v1:130687-130709 ACCAGCTAACATCATAATGACGG - Intergenic
1186913005 X:14189721-14189743 CACAGCCAATATCATACTGAAGG - Intergenic
1187705215 X:22003483-22003505 ACCAGCTAACATCATAATGACGG - Intergenic
1188028034 X:25231715-25231737 CACAGCTAACATCACATTCAAGG + Intergenic
1188201913 X:27301633-27301655 AACAGCTAGCATCATAATGACGG + Intergenic
1188236191 X:27734067-27734089 CACAGTTAACATAATAATCAAGG + Intronic
1190979714 X:55445330-55445352 ACCGGCTAACATCATAATGACGG + Intergenic
1190984297 X:55487528-55487550 CACAGCAAAGATGATAGTGGTGG - Exonic
1191016829 X:55818411-55818433 CACAGCCAACATCACACTGAGGG + Intergenic
1191192976 X:57686354-57686376 ACCAGCTAACATCATAATGACGG + Intergenic
1191194955 X:57710621-57710643 ACCAGCTAAAATCATAATGACGG + Intergenic
1191922594 X:66272279-66272301 ACCAGCTAACAACACAATGGCGG + Intergenic
1192101994 X:68274522-68274544 CTCAGCTAACATGACAAAGGGGG - Intronic
1192243401 X:69352849-69352871 ACCAGCTAACATCATAATGACGG + Intergenic
1192340168 X:70257806-70257828 CTCAGCAAACATCATAAAGAAGG + Intergenic
1192371649 X:70519147-70519169 ACCAGCTAATATCATAATGATGG - Intergenic
1192396093 X:70782425-70782447 ACCAGCTAACATCATAGTGACGG + Intronic
1192826113 X:74697815-74697837 ACCAGCTAACATCATAATGACGG + Intergenic
1192842831 X:74875104-74875126 CACAGCCAATATCATACTGAAGG - Intronic
1192931243 X:75808838-75808860 ACCAGCTAACATCATAATGATGG - Intergenic
1192969002 X:76211282-76211304 ACCAGCTAACATCATAATGACGG + Intergenic
1193484052 X:82064135-82064157 CACAGCCAACATCATACTGAAGG + Intergenic
1193703744 X:84794747-84794769 CAAAGCCAACATCATACTGAAGG + Intergenic
1193776251 X:85646041-85646063 CACAGCCAACATCATACTGAAGG + Intergenic
1194280291 X:91943624-91943646 TACAGCTAACGTCATAATAATGG + Intronic
1194354213 X:92860741-92860763 CATAGCCAACATCATATTGAAGG + Intergenic
1194494610 X:94597950-94597972 TACAGCTAACATCATACTTATGG + Intergenic
1194575983 X:95615040-95615062 CACAGCAAATATCATACTGAAGG - Intergenic
1194781074 X:98026391-98026413 CACAGCCAACATTATACTGAAGG - Intergenic
1195663945 X:107411117-107411139 CACAGCTGACATCATACTTAAGG - Intergenic
1196348962 X:114702667-114702689 ACCAGCTAACATCATAATGATGG + Intronic
1196350556 X:114724550-114724572 ACCAGCTAACATCATAATGATGG - Intronic
1196750305 X:119110361-119110383 CACGGCTAACATCATGGTGAAGG + Intronic
1197016133 X:121627996-121628018 CACAGCTAGTATCATAATGAAGG + Intergenic
1197458295 X:126706116-126706138 CACAGCTAGTATCATACTGAAGG + Intergenic
1198895518 X:141450009-141450031 ACCAGCTAACATCATAATGACGG + Intergenic
1199292539 X:146120966-146120988 ACCAGCTAACATCATAATGACGG + Intergenic
1200597768 Y:5167118-5167140 TACAGCTAACGTCATAATAATGG + Intronic
1201393783 Y:13525986-13526008 ACCAGCTAACATCATAATGACGG + Intergenic
1201570482 Y:15408210-15408232 CCCAGCTAACATCATAATGACGG + Intergenic
1201582939 Y:15530302-15530324 ACCAGATAACATCATAATGATGG - Intergenic
1201627261 Y:16028015-16028037 ACCAGCTAACATCATAATGAAGG + Intergenic
1202040389 Y:20676566-20676588 ACCAGCTTACATCATAATGATGG + Intergenic
1202256107 Y:22921878-22921900 ACCAGCTAACATCATAATGACGG + Intergenic
1202409098 Y:24555631-24555653 ACCAGCTAACATCATAATGACGG + Intergenic
1202461685 Y:25114447-25114469 ACCAGCTAACATCATAATGACGG - Intergenic