ID: 1142949691

View in Genome Browser
Species Human (GRCh38)
Location 17:3468060-3468082
Sequence TTATTTCAACAGATTTAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142949690_1142949691 -8 Left 1142949690 17:3468045-3468067 CCACTCTCATAGATTTTATTTCA 0: 1
1: 0
2: 2
3: 46
4: 427
Right 1142949691 17:3468060-3468082 TTATTTCAACAGATTTAGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 190
1142949689_1142949691 0 Left 1142949689 17:3468037-3468059 CCTAGACTCCACTCTCATAGATT 0: 1
1: 0
2: 3
3: 18
4: 152
Right 1142949691 17:3468060-3468082 TTATTTCAACAGATTTAGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142949691 Original CRISPR TTATTTCAACAGATTTAGCC TGG Intronic
901042507 1:6373982-6374004 TTATTTAAACAGAGTTATACAGG - Intronic
902135597 1:14302073-14302095 TTTTTTCCACACATTTATCCAGG - Intergenic
906505232 1:46373989-46374011 TAATTTTAAGAGATCTAGCCGGG + Intergenic
910572417 1:88720636-88720658 TTATTTCAACAGATTTTGGGGGG + Intronic
915428322 1:155845437-155845459 TCATTTCAACAGAATCAGCAAGG + Intronic
921053956 1:211530333-211530355 TTATATGAACAGATTTATGCTGG - Intergenic
922480035 1:225933758-225933780 TTATTACAAAAGAGTTGGCCAGG - Intergenic
922980704 1:229824167-229824189 TTATTTAAACAAATTGAGACAGG + Intergenic
923129876 1:231065900-231065922 TTATTTCATCAGAGCTACCCTGG - Intergenic
1063185499 10:3646992-3647014 TTATTTTTTCAGATTTAGGCAGG - Intergenic
1065738686 10:28776877-28776899 TTTTTTCAACAGAGTTGTCCAGG - Intergenic
1067115781 10:43434660-43434682 TTATTTCAACAATTTTAGGTGGG + Intergenic
1067413743 10:46087628-46087650 TTATTTCAAAACTTTTGGCCGGG - Intergenic
1071199598 10:83204283-83204305 TTATTTCACCAGATGTAACTGGG - Intergenic
1073601490 10:104850285-104850307 TTATTTCAAAAGCTTCAGCCAGG + Intronic
1080110851 11:28566246-28566268 ATATTTCAAAGGATTTAGGCAGG + Intergenic
1080276945 11:30513354-30513376 TTGTTTCAAGAGGTCTAGCCAGG + Intronic
1081323093 11:41715151-41715173 ATATTTGAAGAGATTTAGGCTGG + Intergenic
1082192976 11:49269481-49269503 TTATTTAAAAAGGTATAGCCTGG + Intergenic
1082286498 11:50323394-50323416 CTATTTTTACAGAATTAGCCAGG - Intergenic
1082943072 11:58728354-58728376 TTTTTTAAAAAGCTTTAGCCAGG - Intronic
1085864295 11:80270504-80270526 TTGTTTGAGAAGATTTAGCCTGG - Intergenic
1086673154 11:89571589-89571611 TTATTTAAAAAGGTATAGCCTGG - Intergenic
1090044677 11:123320800-123320822 TTAATTGAACAGTGTTAGCCAGG + Intergenic
1090220353 11:125016346-125016368 TTATTGCAACAGTTTTTGTCAGG - Intronic
1093296569 12:17399311-17399333 TTATTTCAACAGTTGTAAACTGG - Intergenic
1093401951 12:18756669-18756691 TTAATTCAATATATTTAGGCAGG + Intergenic
1096227581 12:49876422-49876444 TTAAATCACCAGATTTAGCCTGG - Intronic
1096274133 12:50191218-50191240 TTAGTTGAACAGATTTTTCCTGG + Intronic
1097413449 12:59283846-59283868 TTAATACAACAGAATTGGCCGGG + Intergenic
1098046527 12:66406991-66407013 TTTTTTCAACAGACCTACCCTGG - Intronic
1099246356 12:80197507-80197529 TTATTTAAAAAGATTTATTCTGG - Intergenic
1099670926 12:85691066-85691088 TTATTTTAACAGGATTACCCTGG + Intergenic
1101981596 12:109411995-109412017 TTATTTTACCAGATTTTGCATGG + Intronic
1106781172 13:33060593-33060615 TTATTTCAGCAAAACTAGCCAGG - Intronic
1107724161 13:43280952-43280974 TTATTTAAACACATTTAGGCTGG + Intronic
1110342284 13:74406396-74406418 TTCATTCAACAGATTCAGGCTGG - Intergenic
1112885407 13:104164422-104164444 TTATTTAAAAAGATTCATCCTGG + Intergenic
1114506068 14:23214827-23214849 TTCTTTCAACAGATTTGGAAAGG - Intronic
1114794112 14:25693004-25693026 TATTTTCAACAGTTTTTGCCCGG - Intergenic
1120506731 14:85362118-85362140 TTTTTCCAACAGAATTAGACTGG - Intergenic
1120716760 14:87848878-87848900 TTATTCCAAGAGATATAGACAGG - Intronic
1123471649 15:20559092-20559114 TTTTTTTAACAAAATTAGCCAGG - Intergenic
1123646354 15:22441263-22441285 TTTTTTTAACAAAATTAGCCAGG + Intergenic
1123731954 15:23154076-23154098 TTTTTTAAACAAAATTAGCCAGG - Intergenic
1123750090 15:23351458-23351480 TTTTTTAAACAAAATTAGCCAGG - Intergenic
1123893109 15:24801479-24801501 TTTTTTCAACAAATTTTGCAGGG - Intergenic
1123957804 15:25357763-25357785 TAAGTTCATCAGATTTATCCAGG - Intronic
1124282456 15:28375369-28375391 TTTTTTTAACAAAATTAGCCAGG - Intergenic
1124300246 15:28536228-28536250 TTTTTTTAACAAAATTAGCCAGG + Intergenic
1125144172 15:36447122-36447144 TTACTTCAACATTTTTATCCTGG + Intergenic
1126813164 15:52429255-52429277 TTCATTCATCAGATTTAGGCCGG + Intronic
1132472303 16:112248-112270 CTATTTCAACACATCCAGCCAGG + Intronic
1135039134 16:19104465-19104487 TTATTTTAAAAAAATTAGCCAGG - Intergenic
1135397291 16:22140905-22140927 TTATTTTAAGAGATGTGGCCAGG - Intronic
1135800250 16:25488073-25488095 TTATTTCAGCCATTTTAGCCTGG + Intergenic
1136242941 16:28955757-28955779 CTATTTCTACATAATTAGCCAGG - Intronic
1137535609 16:49322127-49322149 TTATTCCACCATATTGAGCCAGG + Intergenic
1141805873 16:86341145-86341167 TGATTGCAACTGATGTAGCCAGG + Intergenic
1142949691 17:3468060-3468082 TTATTTCAACAGATTTAGCCTGG + Intronic
1143192678 17:5051783-5051805 CTATTTCAAGAGACTTATCCAGG - Intronic
1149081478 17:52663447-52663469 TTATTTCAAAAGATTCATTCTGG - Intergenic
1157329811 18:46695486-46695508 TTATTTCAACAAATTTGGGAGGG - Intronic
1157974689 18:52313780-52313802 GAATTTCAACAGATTTAGATAGG + Intergenic
1159667564 18:71180606-71180628 TTATTGCAAAAAAATTAGCCGGG + Intergenic
1160203100 18:76811247-76811269 TTTTTTCAAAAAAATTAGCCAGG - Intronic
1164438025 19:28249266-28249288 TTTCTTCCATAGATTTAGCCTGG - Intergenic
1165989561 19:39801810-39801832 TTATTTGAACAGATTTATAATGG + Intergenic
1168135139 19:54345951-54345973 TTTTTTCTCCAAATTTAGCCTGG + Intergenic
926033669 2:9616223-9616245 TTATTTCAACAAATGGTGCCAGG + Intronic
926843210 2:17105719-17105741 TAGTTTCAGCAGATTTAGGCTGG - Intergenic
929769670 2:44881056-44881078 TTATTTGACCAGCCTTAGCCTGG + Intergenic
930476307 2:51887174-51887196 TTATTTTAGCATATTTAGGCAGG - Intergenic
930868681 2:56148227-56148249 TTATTGCAACAGTTTCAGACAGG + Intergenic
931748724 2:65312821-65312843 TCATTTCAACAGATTTTGGGGGG + Exonic
931750647 2:65326999-65327021 TTTTTTCAAAAAAATTAGCCAGG - Intronic
932354743 2:71059476-71059498 TTATTTGCACAGATGTAGTCTGG - Intergenic
933109218 2:78375878-78375900 TTTTTTCAATTGATATAGCCAGG + Intergenic
933933260 2:87177363-87177385 TTTTCTTAAAAGATTTAGCCAGG - Intergenic
936359854 2:111788083-111788105 TTTTCTTAAAAGATTTAGCCAGG + Intronic
938963017 2:136360145-136360167 TTATTTTAAAAGCTTTAGACAGG - Intergenic
941557647 2:167002269-167002291 TTTTTTAAACAGATTTATCCAGG - Intronic
941927338 2:170909180-170909202 ATATTTTAACAAAATTAGCCGGG + Intergenic
943829687 2:192444492-192444514 TTATTTGAACATATTTTGCATGG + Intergenic
945154891 2:206828163-206828185 TTACTTCAACAGATTCCGACTGG + Intergenic
1170143946 20:13152687-13152709 TTATTCCAACTGATTAAGACTGG + Intronic
1172004269 20:31807251-31807273 TGATTTCAACAGACTAAACCTGG + Intergenic
1174502804 20:50997981-50998003 TTATTTCAACAAATTGAGCTTGG + Intergenic
1174523379 20:51151962-51151984 TCCTTTCAACAGATATAGCTGGG + Intergenic
1177066975 21:16450830-16450852 TTATTTCTACAGATTTATTTTGG + Intergenic
1177421476 21:20863543-20863565 TTATTTCAACACATTGAGAAAGG - Intergenic
1178030017 21:28514490-28514512 TAATTTGAAAATATTTAGCCTGG + Intergenic
1180227636 21:46405078-46405100 TTTTTTTAAAAAATTTAGCCAGG + Intronic
949441153 3:4082169-4082191 TTATTTTAAAAAAGTTAGCCTGG + Intronic
949777208 3:7646614-7646636 TTTTGTCAACAGCTTTTGCCTGG + Intronic
949799692 3:7890098-7890120 TTATTTCAATAGATTTTGGGGGG - Intergenic
950952825 3:17018537-17018559 TTTTTTCAACAGATGGGGCCTGG + Intronic
951359549 3:21708802-21708824 TTAATTAAACAGATTTAGAAAGG - Intronic
952839615 3:37633858-37633880 TTATTTCAAAAGCTTTTCCCAGG - Intronic
953756058 3:45646818-45646840 TAATTTCAAAAAAATTAGCCAGG - Intronic
957881768 3:86224197-86224219 TTTTTTCCAAAGATTAAGCCTGG + Intergenic
958543019 3:95503968-95503990 TTATCTCATCAGATTTTGGCAGG + Intergenic
959251577 3:103954626-103954648 TTATTTCAGAAAATTTAGCATGG + Intergenic
962514553 3:136138230-136138252 TTATTTCAACAGATATTTACTGG + Intronic
963996247 3:151712406-151712428 TTATTTCAACAGATTTGGGGGGG - Intergenic
965937758 3:174135864-174135886 TTATTTCACCAGATTTGATCTGG - Intronic
966437185 3:179901615-179901637 TTATTTCAAGAAATTAAACCAGG - Intronic
966531161 3:180981976-180981998 TTATCTCTACAGATCTAGCTTGG - Exonic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
968855329 4:3116010-3116032 CTTTTTTAACAGATTAAGCCGGG + Intronic
970179657 4:13377662-13377684 TTATTTTAACAGCATTAGTCTGG + Intronic
971610131 4:28713484-28713506 TTATTTCAAAATATTTACCTAGG + Intergenic
971779314 4:31010966-31010988 ATATTTCAACAGATTTATCGGGG - Intronic
971837307 4:31784334-31784356 TTATTTCAAAAGGTTTAGGTAGG - Intergenic
972903448 4:43714311-43714333 TTTTTTGAAAAAATTTAGCCAGG + Intergenic
973841682 4:54867801-54867823 TTATTTCAAGAGAATTAACTTGG - Intergenic
974192136 4:58519098-58519120 ATAATTCAACAGATTTGGGCAGG + Intergenic
974258451 4:59492681-59492703 TTTGTTCAACAGATGTATCCAGG - Intergenic
975049767 4:69847289-69847311 TTATTTAAACATATTAAGCATGG + Intronic
976141529 4:81998146-81998168 TTATTTCTACAGATTTAGAGAGG - Intronic
977832545 4:101611037-101611059 TTAATTCACCAAATTTATCCAGG - Intronic
978749253 4:112228699-112228721 TTAGTTAAACAGAATTAGCAGGG - Intergenic
979655102 4:123183098-123183120 TAATTTCAGAAGATTCAGCCAGG + Intronic
980279132 4:130695141-130695163 TTATTTTAAATGAATTAGCCTGG - Intergenic
982027607 4:151266984-151267006 TTAATTTAACAGATCTAGCCAGG + Intronic
984172022 4:176370346-176370368 TTTTTTCATCAGAATTAGCTGGG + Intergenic
984314630 4:178111930-178111952 TTATTTCAATAGAGTTATCTTGG - Intergenic
988690541 5:33567644-33567666 TTGTTTCAAAACATCTAGCCTGG + Intronic
989222414 5:38983467-38983489 TTATTTTAAAACTTTTAGCCAGG - Intronic
990378621 5:55199133-55199155 AGTTTTCAAAAGATTTAGCCAGG + Intergenic
990454709 5:55973933-55973955 TCATTTTATCAGTTTTAGCCTGG - Intronic
991657604 5:68919764-68919786 TTCTTTTCACAGTTTTAGCCTGG - Intergenic
992710034 5:79443223-79443245 TCATTTCAAAGTATTTAGCCTGG - Intronic
993018795 5:82565462-82565484 TCATTTCAGCCAATTTAGCCTGG - Intergenic
993274679 5:85841802-85841824 TTATTTGTACAGATTTCTCCTGG + Intergenic
993344133 5:86761456-86761478 GTACTTCAACAGATATAGCTAGG - Intergenic
993651463 5:90528107-90528129 TTATTTCCACTCATTTAACCAGG + Intronic
994357342 5:98808635-98808657 TTATCTCACCAGAGTTAGCATGG + Intergenic
994698787 5:103106632-103106654 TTATTTCTCCAGATTTATTCTGG - Intronic
997665373 5:135626043-135626065 TTATTTCATCAGGTTCAGCCTGG - Intergenic
998674280 5:144389660-144389682 TTTTTTCCACAGATTGGGCCAGG - Intronic
1000554969 5:162715274-162715296 TTATTTTGACAGATTTAACCAGG - Intergenic
1005850808 6:29819465-29819487 TTATTTCAAAAGTTTAAGCCAGG + Intergenic
1007063208 6:38963107-38963129 TTATTTCAACAGGTTTTGGGGGG - Intronic
1009707237 6:67267028-67267050 TTATTTCAACAAATGGATCCTGG - Intergenic
1010442758 6:75917199-75917221 TGATTTCCACAGTTTTAACCTGG - Intronic
1011346747 6:86378577-86378599 TTATCTTAACACAGTTAGCCAGG + Intergenic
1011512206 6:88113810-88113832 TTATTTTAAAAGTTTTAGGCCGG + Intergenic
1012180508 6:96146777-96146799 TTATTTCAAAAGATGAATCCAGG + Intronic
1014434282 6:121404495-121404517 TTATTTTAACAGATTTTCCTAGG + Intergenic
1016089980 6:139965029-139965051 TTATTTCCTTAGATTTATCCCGG - Intergenic
1016293753 6:142551880-142551902 TGATTTCCACAGATTTTGCCTGG - Intergenic
1016635673 6:146287380-146287402 TTATTTCACCACATTTAGGAGGG + Intronic
1018024878 6:159797152-159797174 TTACTTCAACATATTTAACTTGG - Intronic
1018506612 6:164476928-164476950 TTATTTCTGGAGATTTATCCAGG + Intergenic
1019508915 7:1407511-1407533 TTAAATACACAGATTTAGCCAGG - Intergenic
1019872522 7:3778521-3778543 TTATTTCTACAGATCTGACCAGG + Intronic
1020362183 7:7339237-7339259 TTATTTCAATTAATTTAGCTGGG - Intergenic
1020789325 7:12606204-12606226 TTATATCAACAGATTTTGACAGG - Intronic
1021454656 7:20816637-20816659 ATCTTTCAAAAAATTTAGCCTGG + Intergenic
1022761430 7:33357991-33358013 TTATTTCAACAGTCTTACCTGGG - Exonic
1023369069 7:39494805-39494827 GTATTTCAACAGCTTTATGCAGG - Intergenic
1023753118 7:43390617-43390639 TCATTTCCTCAGATCTAGCCTGG - Intronic
1024662696 7:51513927-51513949 TTGTTTCAAAAGACCTAGCCAGG + Intergenic
1024734783 7:52293540-52293562 GTATTTCTACAGAAGTAGCCTGG + Intergenic
1026104218 7:67408226-67408248 TTCTTGCTACACATTTAGCCAGG - Intergenic
1028559813 7:92161692-92161714 TGATTTCATGAGTTTTAGCCTGG + Intronic
1029254017 7:99256788-99256810 TTAATTAAACAAAATTAGCCAGG + Intergenic
1029422959 7:100480806-100480828 TTTTTTAAAGAAATTTAGCCAGG - Intergenic
1031894124 7:127328542-127328564 TTATTTCAACAGTTTTAGAATGG - Intergenic
1032752528 7:134855840-134855862 TTCTTTCAAGATATTTAGCCCGG + Intronic
1032938253 7:136758823-136758845 TTATTTAAAAATATTTAACCTGG + Intergenic
1032994816 7:137433146-137433168 ATATTTTAACAGCTTTATCCAGG + Intronic
1035636387 8:1148994-1149016 TTAATTGATCAGATTTATCCAGG + Intergenic
1036042890 8:5106047-5106069 TTATTTCAACATTTTAAGCAAGG + Intergenic
1036494813 8:9260638-9260660 TTCATTCAACAGACTTAGACTGG - Intergenic
1038596170 8:28888718-28888740 TTATATAAACAGATTTATACGGG + Intronic
1038599426 8:28924505-28924527 TTATGACATCAGATTTAGCAAGG - Intronic
1038966459 8:32578287-32578309 TTATTTAAAAAGATCTGGCCGGG - Intronic
1043505096 8:80894683-80894705 TTATTTATTCAGATTTAGTCTGG + Intergenic
1044961873 8:97539117-97539139 TTAATTCAACAGATTTTCACTGG - Intergenic
1045577967 8:103446498-103446520 TTATTTAAATAGATTAAGTCAGG + Intergenic
1047063919 8:121259288-121259310 TTATTTTCACAGATGTAGCCTGG + Intergenic
1047718162 8:127614870-127614892 TTTTTTGAACAGATTGAGCAAGG + Intergenic
1048558084 8:135501537-135501559 TTAATTCAACAGATTTGAGCTGG + Intronic
1048605788 8:135967434-135967456 TTATTTCAACAGATGCAGACTGG + Intergenic
1050947617 9:11546118-11546140 ATATTTCAAAAGATTCACCCTGG - Intergenic
1051815239 9:21096881-21096903 TAATTTCAAAAGAACTAGCCAGG - Intergenic
1052160467 9:25251732-25251754 TTATTTAAGCAGATTTAACATGG + Intergenic
1052730543 9:32280137-32280159 TTGTTTCTACTGATTTGGCCAGG - Intergenic
1055817176 9:80220426-80220448 TTTTTTAAACAGAGTTGGCCGGG + Intergenic
1056337486 9:85588227-85588249 TTATTTCAACAAGTTTATACAGG + Intronic
1059167949 9:112097004-112097026 TTTTTTTATCAGATTGAGCCTGG - Intronic
1059223110 9:112644528-112644550 CAATTTGAACAGATTAAGCCTGG + Intronic
1061028525 9:128066221-128066243 TTTTTTCAACAAATATGGCCTGG + Intronic
1061624057 9:131830610-131830632 TTATTTAAAAAGATGTAGGCCGG + Intergenic
1186173464 X:6901570-6901592 ATTATTCAACAGATTCAGCCAGG - Intergenic
1186288928 X:8075483-8075505 TGATTTCAACAGATTTGGCCAGG - Intergenic
1186620933 X:11239419-11239441 TTATTTCACTAGTTTCAGCCTGG - Intronic
1188813477 X:34682245-34682267 TTTTTTAAAAAAATTTAGCCGGG - Intergenic
1189808831 X:44762324-44762346 TAATTTTTACAAATTTAGCCAGG + Intergenic
1189937527 X:46085418-46085440 TTATATTAACAGATTTAGGAAGG - Intergenic
1190894619 X:54604940-54604962 TTATCTTAACTGATTTGGCCTGG + Intergenic
1192060356 X:67818018-67818040 TTTTAACAGCAGATTTAGCCAGG + Intergenic
1192089523 X:68138934-68138956 TTAATTTTACAGATTAAGCCAGG - Intronic
1192696511 X:73421845-73421867 TCATTTCAACCAGTTTAGCCTGG + Intergenic
1193880581 X:86916249-86916271 TTATTTCAACAAGTTTTGCATGG + Intergenic
1194079016 X:89434660-89434682 TTATTTGAACATATTTATCATGG + Intergenic
1196923461 X:120608368-120608390 ATTTTTCAGCAGTTTTAGCCTGG - Intronic
1198064889 X:133086447-133086469 TTTTTTAAAAAGAATTAGCCAGG + Intronic
1200431638 Y:3089978-3090000 TTATTTGAACATATTTATCATGG + Intergenic